Labshake search
Citations for New England Biolabs :
2251 - 2300 of 2930 citations for Acyl protein thioesterase 2 LYPLA2 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 575 embryos were injected with a mixture containing 300 ng/μL of sgRNA (one guide) and 600 ng/μL of Cas9 protein (NEB, M0641) while for Dll ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 Spike mutant D614G was generated by site-directed mutagenesis using as an input DNA the expression vector encoding SARS-CoV-2 Spike_614D protein (kindly provided by J. Garcia-Arriaza, CNB-CSIC) by Q5 Site Directed Mutagenesis Kit (New England Biolabs, Barcelona, Spain) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The fusion protein was purified from the clarified supernatants by adding 20 ml of chitin resin (New England Biolabs, cat#S6651S) and incubating with gentle rotation overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... The non-15N 4R tau used for small-scale chemical in vitro crosslinking was phosphorylated using cAMP-dependent Protein Kinase (PKA, catalytic subunit, New England Biolabs #P6000S) according to manufacturer guidelines (25uL reaction at 30°C for 2 hours with 200 μM ATP ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.
-
bioRxiv - Synthetic Biology 2021Quote: ... and a maltose binding protein (MBP) (65) and Factor Xa sequence derived from pMAL-c5X vector (New England Biolabs, Ipswich, MA) with a V313A mutation to be consistent with the native E ...
-
bioRxiv - Bioengineering 2020Quote: ... 200-500 ng of the purified PCR product was used as DNA template in 25 μl of coupled in vitro transcription and translation reaction using PURExpress In Vitro Protein Synthesis Kit (New England Biolabs, E6800L). The reaction was incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... were performed with 5-10 μM final protein concentration and 10 μM dye (SNAP-Surface Alexa Fluor488 (New England Biolabs S9129S) or SNAP-Surface Alexa Fluor647 (New England Biolabs S9136S) ...
-
bioRxiv - Developmental Biology 2021Quote: ... After annealing the complex an equimolar amount was mixed with 1000 ng Cas9 recombinant protein (NEB; final concentration 20 ng/μL) and incubated at RT for 15 min ...
-
bioRxiv - Synthetic Biology 2021Quote: 8.3 μM bdSUMO-HSPB611–20 fusion protein containing pSer or nhpSer at site S16 of HSPB6 were reacted with 3 units of λ phosphatase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: ... the TEV protease was removed by incubation of the purified protein with 250 µL amylose resin (New England Biolabs, Hitchin, UK). Protein concentrations were determined by the bicinchoninic acid assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... for each co-expressed DF-APOBEC1 protein using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L) with NEBNext Poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... Purified protein (4 μg) was deglycosylated with 500 U of Endoglycosidase H (Endo H) (New England Biolabs, Ipswich, MA, United States) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... Strep–PIF4 recombined proteins were expressed in the Escherichia coli BL21 (DE3) strain and then purified using amylose resin (NEB, E8021S). DNA probes of NHX1 and SAL1 were synthesized and labeled using the Biotin 3′ End DNA Labeling Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... the particles were captured by magnetic stand and proteins captured by the particles were separated by SDS-PAGE and examined by immunoblotting using MBP antibody (NEB, #E8032S). For the immunoblot ...
-
bioRxiv - Biochemistry 2024Quote: ... the crude extract containing 100 μg (in 100 μL volume) of proteins was treated with 400 units of λ-PPase (#P0753; New England Biolabs) for 60 min at 30 °C ...
-
bioRxiv - Cell Biology 2024Quote: All purified SNAP-tagged proteins were labeled with 10-fold molar excess of SNAP-Surface dyes (New England Biolabs, Ipswich, MA) in labeling buffer (1× PBS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we constructed the genetic sequence of the major shell protein of 50nmGVs using Q5 DNA polymerase and Gibson assembly kits (New England Biolabs Inc.)65 ...
-
bioRxiv - Microbiology 2023Quote: ... Each protein was then isolated and affinity-purified using an amylose resin according to the manufactureŕs protocol (New England Biolabs, Ipswich, US) and the concentration was determined using the Bradford technique ...
-
CXCL17 binds efficaciously to glycosaminoglycans with the potential to modulate chemokine signallingbioRxiv - Immunology 2023Quote: ... WT SUMO3-CXCL17 and variants were expressed as soluble proteins in SHuffle® T7 Competent E.coli (New England Biolabs, Hitchin, UK). In both protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein was then purified by affinity-purification using an amylose beads according to the manufacturer’s protocol (New England Biolabs, Ipswich, USA) and the concentration determined by Bradford assay ...
-
bioRxiv - Cell Biology 2023Quote: Beads with bound Flag-RAD50 or GFP-BRCA1 were washed with 5M NaCl to eliminate contamination with protein kinases and incubated with 100 or 500 U of CK2 holoenzyme complex (α2/β; NEB) in 30 μl of kinase buffer (20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Trypsin digestion was initiated by adding 1:10 (trypsin to protein, m/m) mass spectrometry grade trypsin (New England Biolabs #P8101S) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2024Quote: The cell lysates or purified PINK1 bound to FLAG beads were incubated at 30°C for 1h with 200 units of ʎ protein phosphatase (LPP) in a total reaction of 100µL following the instructions of the manufacturer (New England Biolabs #P0753).
-
bioRxiv - Cell Biology 2024Quote: We fused SNAP-3xHA coding sequences downstream H3.1 and H3.3 CDS 46 and inserted this fusion protein into the pBS31 vector 70 using NEBuilder® HiFi DNA Assembly Master Mix (NEB). These expression vectors (pB31-H3.1- and pB31-H3.3-SNAP-3xHA ...
-
bioRxiv - Microbiology 2020Quote: ... purified and ligated for 2 h at room temperature using the Instant Sticky-end Ligase Master Mix (NEB, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified using the Luna Universal Probe Onestep RT-qPCR kit (New England Biolabs) and US CDC real-time RT-PCR primer/probe sets for 2019-nCoV_N1 ...
-
bioRxiv - Genetics 2021Quote: Cells from each fin sample obtained as described before were washed in 2 ml PBS supplemented with 0.1% bovine serum albumin (BSA) (NEB). Each sample was divided into two replicate tubes ...
-
bioRxiv - Microbiology 2020Quote: ... These gBlocks fragments and a NdeI-HindIII-digested pET21b backbone were assembled using a 2× Gibson master mix (NEB). Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and then a final extension at 72°C for 2 minutes using Q5 High-Fidelity Polymerase (New England BioLabs). We conducted a nested PCR to sequence exon 2 (204bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Biophysics 2022Quote: ... both were mixed (∼5μM acceptor strand and ∼2 μM phosphorylated donor strand in a final volume of 19μl) in T4 RNA ligation buffer (New England BioLabs) supplemented with 1mM ATP (New England BioLabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 198 µL A-tailing solution (1× NEB buffer 2, 500 mM dATP, 1% Triton X-100). DNA ends were A-tailed by adding 1.5 µL Klenow (exo- ...
-
bioRxiv - Developmental Biology 2020Quote: ... oligonucleotides for the HAS-1 or HAS-2 sgRNA guide sequences were phosphorylated using T4 PNK (NEB, Ipswich, MA) for 30 min at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... Single cells were flow-sorted into 96-well plates containing 2 µL of nuclease-free water with 0.2% Triton X-100 and 4 U murine RNase inhibitor (NEB), centrifuged ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment (sense/anti-sense) Pceh-23_L::acy-2 fragment(sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Molecular Biology 2019Quote: ... SI) were incubated for 2 hours at RT in T4 ligase buffer with 400 U of T4 ligase (NEB) in a total volume of 100 µl ...
-
bioRxiv - Genetics 2021Quote: ... 53.5 μl of cut 3C library was mixed with 6.5 μl NEBNext FFPE Repair Buffer and 2 μl NEBNext FFPE Repair Mix (New England Biolabs), followed by incubation at 20°C for 15 minutes and addition of 3 volumes of AMPure XP beads for purification.
-
bioRxiv - Plant Biology 2020Quote: ... A 3 μl aliquot of the purified DNA fragments was blunted in a 20 μl reaction containing 2 μl buffer 2.1 (New England Biolabs), 1 μl 2 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... and assembled with oncocin and true negative oligo inserts (Supplementary Table 2) with NEBuilder® HiFi DNA Assembly (NEB), and cloned in 5α E ...
-
bioRxiv - Bioengineering 2021Quote: The LAMP reagent mix in a total volume of 25 μL contained 12.5 μL of WarmStart or Colorimetric WarmStart 2 × Master Mix (New England BioLabs) or Bsm polymerase (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... non integrated plasmids were cut by 2 h digestion at 37 °C with I-CeuI restriction enzyme (NEB, R0699S) in a total volume of 70 ul followed by 20 minutes heat inactivation at 65 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Pre-hybridization Buffer was replaced with 250 μl of Hybridization Buffer (2x SSC, 10% deionized formamide, 0.1% Tween-20, 2 mM vanadyl ribonucleoside complex (New England Biolabs), 100 μg/mL salmon sperm DNA (Invitrogen) ...