Labshake search
Citations for New England Biolabs :
2301 - 2350 of 10000+ citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... The genomic DNA was incubated in a mix containing S-Adenosyl methionine (SAM) along with the DNA adenine Methyltransferase (dam, NEB, USA) and its corresponding buffer for 4 hours at 37°C ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... the whole shuttle plasmid was PCR-amplified with overlapping primers containing the desired insert and recircularised by NEBuilder (New England Biolabs, #E2621L) recombination.
-
bioRxiv - Molecular Biology 2022Quote: ... pCS2+ backbones containing ACVR1 or an FOP-ACVR1 mutant were PCR amplified with the mutant primer using Phusion high fidelity polymerase (NEB, M0530). Mutated plasmids were transformed into Top10 chemically competent cells and DNA from individual colonies was submitted for Sanger sequencing ...
-
bioRxiv - Genomics 2022Quote: We first generated a transfer vector containing a reporter gene (hsp68 promoter + mScarlet) flanked by φC31 and BxbI attB sites using HiFi Assembly (NEB #E2621). The insulator sequences were obtained from their respective papers (cHS4 from Chung et al.9 ...
-
bioRxiv - Molecular Biology 2022Quote: PANK3 mutations were made in a gateway compatible pDONR plasmid containing a PANK3 ORF (a gift from the lab of Ben Cravatt) by amplifying the whole plasmid with primers containing the desired mutations and using HiFi DNA Assembly Master Mix (NEB, # E2621) to re-circularize the amplicon ...
-
bioRxiv - Microbiology 2022Quote: ... the CPER product was subject to post-PCR nick sealing for 30 min at 50°C and 30 min at 60°C in a 25 μL reaction containing 1 mM β-nicotinamide adenine dinucleotide (NAD+) (NEB) and 0.5 μL HiFi Taq DNA ligase (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... the PCR products containing the geneticin1-664-PgpdA-RB and the SpecR-Ori were digested with SapI (New England Biolabs, UK) and ligated with T4 DNA ligase ...
-
bioRxiv - Plant Biology 2023Quote: ... Type-IIS cloning was performed as described previously (Cai et al., 2020) using a Master Mix containing 10% (v/v) 10× T4 DNA ligase buffer (NEB #M0202), 2.5% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-5 μM SNAPf fused activator was incubated in a 1× PBS solution containing up to threefold excess of SNAP-surface 649 (New England BioLabs, #S9159S), 1 mM DTT ...
-
bioRxiv - Cancer Biology 2023Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml Tris buffer (10 mM Tris HCl (pH 8.0)) ...
-
bioRxiv - Genomics 2022Quote: ... We then ordered an oligo containing 16 Ns with flanking homology arms to the landing pad plasmid (GWLP P1) and used HiFi Assembly (NEB #E2621) to assemble the oligo to the plasmid (50℃ ...
-
bioRxiv - Genetics 2023Quote: ... Every marker was amplified in 20 μl of a reaction mix containing a 1X Standart Taq Reaction Buffer (M0273E, New England BioLabs Inc.), 0.4 μl of 10 mM dNTP ...
-
bioRxiv - Genomics 2023Quote: ... genomic DNA was digested using two restriction enzymes and adaptors containing unique barcodes were ligated to each sample for multiplexing (using CutSmart buffer® NEB). The ligated products were PCR amplified in replicates of four using Q5 Hot Start Polymerase® NEB for 20 cycles with a starting DNA volume increased to 7ul per reaction ...
-
bioRxiv - Microbiology 2023Quote: ... Two μl of a 1:250 dilution of the annealed oligos were ligated to 50 ng of dephosphorylated BsaI-digested vector at 16°C overnight in 20 μl final volume containing 1x T4 DNA ligation buffer (NEB, B0202S), and 400U T4 DNA ligase (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Poly-A containing RNA was enriched from the total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, E7490S) and sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep with Sample Purification Beads (NEB E7765S) ...
-
bioRxiv - Genomics 2023Quote: Nuclei were resuspended in 200 uL of Methylation Reaction Buffer (Buffer M containing 1mM S-adenosylmethionine (SAM)) (New England BioLabs B9003S). 10uL high-concentration EcoGII was added per 1e6 nuclei and the nuclei suspension was incubated at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... two homology parts and an integration cassette part were combined with the ColE1 origin-containing pYTK095 backbone53 using BsaI-HF v2 Golden Gate assembly (New England Biolabs, USA). As before ...
-
bioRxiv - Molecular Biology 2023Quote: ... 250ng of polyA(+) RNA were ligated to pre-annealed custom RT adaptors (IDT) containing barcodes 78 with T4 DNA concentrated Ligase (NEB-M0202M) for 15 min at RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... pPGK1-mCherry was amplified from the mCherry plasmid described in (Tunney et al. 2018) using uracil-containing primers with Q5U polymerase (New England BioLabs, M0515) and inserted into EasyClone plasmid pCfB2226 by USER cloning upstream of the ADH1 terminator with USER Enzyme Mix (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... 60 containing human RNaseH1 with D210N catalytic dead mutant was amplified by PCR for cloning in pEGFP-N1 using EcoRI (NEB, #R3101S) and KpnI (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... or ubi4-REE-act1(till the stop codon) was generated using pcr from plasmids containing these sequences using the following primers and Phusion polymerase (New England Biolabs: M0530S) (F:AATCAACGGCTTCATACCACCTCAGCCAGCCGTGT TATAACTTACCGTTTACCAACTACATTTTTTGTAACG AACCAAAAAACCCTCAAAAGACAAGACCATGCAGA TTTTCGTCAAGAC R ...
-
bioRxiv - Biochemistry 2024Quote: The coding sequence of human EIF4EBP1 (NM_004095.4) was amplified from cDNA derived from HepG2 cells using primers containing restriction sites using Q5 polymerase (New England Biolabs, M0491). PCR products were cloned into suitable vectors using restriction digest followed by ligation ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μL template cDNA/DNA was used in a 20 μL reaction containing 10 μL Luna® Universal qPCR Master Mix (New England Biolabs). The qPCR program was ...
-
bioRxiv - Microbiology 2023Quote: ... using the kit Luna® Universal qPCR Master Mix Kit (New England Biolabs, Ipswich, MA, United States). PCRs were conducted in a total volume of 20 µl containing 10 μL of Luna Universal qPCR Mix ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB).
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB). The specificity of AlkB repair reaction was confirmed using an inactive AlkB control reaction in which Fe2+ ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... or FLAG (amino acid sequence: DYKDDDDK) with a kit (Gibson assembly kit from New England Biolabs, catalogue # E5510S). The different combinations were cloned into pJFRC7-20XUAS-IVS-mCD8::GFP (Addgene # 26220 ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the NEBNext Ultra DNA Library Prep Kit (kit number E7370L, New England Biolabs) and 8 cycles of PCR ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated from blood (QiaAmp DNA Mini Blood Kit, Qiagen; or Monarch Genomic DNA purification kit, NEB) or from perfused organs homogenized (Fisher Bead Mill 4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... NEB One Taq RT-PCR kit (One Taq® RT-PCR Kit, New England Biolabs INC, Frankfurt, Germany) was used for cDNA synthesis ...
-
bioRxiv - Genetics 2021Quote: ... 0.5 μM MPRA_v3_F and MPRA_v3_20I_R primers (Supplementary Table 14) and 2 ng BSA (NEB, B9000). PCR master mix was emulsified by vortexing with 220 μL Tegosoft DEC (Evonik) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... treated ~2 μg RNA with RNase-free DNase I (Catalog# M0303S NEW ENGLAND Biolabs, USA), then used 1 μL treated RNA in cDNA synthesis with SuperScript III Reverse Transciptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro was opened with BsrGI-HF (NEB) and EcoRI-HF (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were washed in PBS-T and blocked in PBS-T + 2% BSA (NEB, B9000) + 5% donkey/goat serum (Jackson Immunoresearch/Dianova ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 500 ng of chromatin-bound or nucleoplasmic RNA with 2 µl Quick CIP (NEB) in a total volume of 20 µl for 90 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Multiplex Oligos for Illumina (NEB, Set 1; cat. # E7335, NEB, Set 2; cat. # E7500) were used for multiplexing ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 2 (supplied by NEB, 500 mM Sodium Phosphate, pH 7.5), and 1 μL of PNGase ...
-
bioRxiv - Biochemistry 2020Quote: ... pre-tRNA stock was diluted 1 in 2 into RNA loading buffer (New England Biolabs) and separated on a 10% acrylamide urea-TBE denaturing gel ...
-
bioRxiv - Immunology 2021Quote: ... PCRs were performed with Phusion High-Fidelity DNA Polymerase (2 U/µL) (New England Biolabs) in a total volume of 50 μl ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR was performed using Q5® High-Fidelity 2× Master Mix (New England Biolabs, US). The point mutation in dCas9 to create H840A Cas9n was made using Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Bioengineering 2020Quote: ... or colony PCR using Q5® High-Fidelity 2× Master Mix (New England Biolabs, US) if a chromosomal region was targeted ...
-
bioRxiv - Biochemistry 2021Quote: ... The sample was then resuspended in 100 μl/sample volume of 1X NEBuffer 2 (NEB) supplemented with Triton X-100 to 0.1% and transferred to a new tube ...
-
bioRxiv - Cancer Biology 2021Quote: ... were incubated at 37 °C for 2 hours in 1x T4 DNA ligase buffer (NEB). Following this incubation 1200 units T4 DNA ligase (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA (2 μg) was digested with the AluI restriction enzyme (New England Biolabs, U.S.A) and purified by using an illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare ...
-
Cellular and structural basis of synthesis of the unique intermediate dehydro-F420-0 in mycobacteriabioRxiv - Biochemistry 2020Quote: ... For Southern blotting analysis 2 μg of gDNA was digested with appropriate restriction enzymes (NEB) at 37 °C for 16 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... 1μL DNase I and 2 μL 10x DNase buffer (New England Biolabs, Ipswich, MA, USA), and incubated for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... Mif2 was treated for 2 h at 30 °C with lambda-phosphatase (New England Biolabs) according to the manufacturer’s instruction ...