Labshake search
Citations for New England Biolabs :
2551 - 2600 of 10000+ citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Each sample was analyzed in duplicate 10-µl reactions containing 5 µl Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA), 2 µM of each primer ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR amplification was performed with 10 µl of the reverse transcriptase product in a 50 µl PCR mix containing 1 unit of Phusion High-Fidelity DNA polymerase (New England Biolabs, Évry-Courcouronnes, France), 1X HF Phusion buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... we amplified PCR fragments with the respective primers containing the gRNA sequences (Table S1) and utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Cat. No: M0494L). After gel-purification of the PCR fragments with the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixture containing RBBP6/CPSF/RBBP6+CPSF and MBP-MS2-bound L3 pre-mRNA was mixed with amylose beads (NEB, cat. No. E8021) equilibrated in pull-down buffer and incubated rotating at 4°C for 1.5 h ...
-
bioRxiv - Genomics 2024Quote: ... samples containing a mixture of single-cell ATAC and RNA libraries were resuspended in the pre-amplification mastermix containing 1x NEBNext HF 2x PCR Master Mix (NEB, catalog no. M0541L) and a combination of three primers ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... In vitro methylation experiments were performed for 10 min (DNA) or 1 h (RNA) at 37 °C in 8 μL reaction mixtures containing 1× CutSmart buffer (New England Biolabs Inc., Massachusetts, USA) with 20 nM DNA or 50 nM RNA with 1 unit RNase Inhibitor (New England Biolabs Inc. ...
-
bioRxiv - Bioengineering 2023Quote: ... a PCR template containing the primer CRISPR-R and a CRISPR-F (containing the target sequence and a T7 promoter) were self-annealed and amplified using Phusion® (New England BioLabs, Ipswich, MA) polymerase with the following conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... we dispensed 5 μL of a sense oligo and then added 40 μL of phosphorylation reaction mix containing 1 μL of T4 Polynucleotide Kinase (PNK; NEB, cat. no. M0201S), 5 μL of T4 PNK buffer (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Washed Dynabeads containing the DNA-complexes were directly resuspended in 20 µL USER reaction buffer containing 10 µL StickTogether DNA Ligase Buffer 2x (NEB, cat. no. B0535S), 1.5 µL USER Enzyme (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The initial dephosphorylation reaction was in a mixture (50 μL) containing 5 μL of terminal transferase buffer (NEB Tdt Reaction Buffer, Catalog # M0315S), 1 μL of shrimp alkaline phosphatase (rSAP ...
-
bioRxiv - Microbiology 2024Quote: ... The initial dephosphorylation reaction was in a mixture (50 μL) containing 5 μl of terminal transferase buffer (NEB Tdt Reaction Buffer, Catalog # M0315S), 1 μL of shrimp alkaline phosphatase (rSAP ...
-
bioRxiv - Bioengineering 2024Quote: ... along with a well containing 10 µl Quick-Load® Purple 1 kb DNA Ladder (New England Biolabs catalog no. N0552S; New England BioLabs, Ipswich, MA) and ran at 105 V for 45 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... the synthesized sgB was injected at 300ng/µL after 5-minute incubation at RT with Cas9 protein (NEB) at 2µM final in 20mM Hepes-NaOH pH 7.5 ...
-
bioRxiv - Evolutionary Biology 2021Quote: Both HLS-C and HLS-E protein at 1 mg/mL were incubated with human Furin (EC 3.4.21.75, P09958, obtained from NEB P8077) in digestion buffer (10 mM HEPES (pH 7.5) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cell lysis was cleared by centrifugation at 16,100g for 10 min and 0.65 ml supernatant was mixed with 50μl Protein G beads (NEB, #37478S) pre-conjugated to U1-70K antibody (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... Samples were pre-cleared by adding 40 µl Protein A Magnetic Beads (New England Biolabs, MA, United States) and rotating at 4°C for 60 min ...
-
bioRxiv - Cell Biology 2019Quote: ... Lysates containing 800μg of protein in a total of 400μl lysis buffer were pre-cleared by incubation with 15μl of Protein A magnetic beads (New England Biolabs) for 1h at 4°C under agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... Cas9 RNPs were formed by incubating 1 pmol of sgRNA with 0.5 pmol of Cas9 protein in 1X NEBuffer™ 3.1 or 2.1 (NEB) at room temperature for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... on ice for 30 min and protein concentration measured by BCA assay (7780, New England Biolabs, Beverly, USA). Results were analyzed using the Compass software (ProteinSimple) ...
-
bioRxiv - Microbiology 2020Quote: ... or CatL-cleaved GPs were incubated with Protein N– glycosidase F (PNGaseF, 250U; New England Biolabs, Ipswich, MA) under reducing conditions for 16 h at 37℃to remove N–linked glycans ...
-
bioRxiv - Molecular Biology 2021Quote: ... PARP1 and SET8 GST-fusion and mutant proteins were induced in Escherichia coli ER2566 cells (New England Biolabs
-
bioRxiv - Molecular Biology 2022Quote: ... Removal of sialic acids was performed using the α2-3,6,8 neuraminidase (New England Biolabs, 50 U/μg protein). Removal of fucose was performed using α1-2,4,5,6 fucosidase O (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg antibody (Table. S3) and 50 µl protein A magnetic beads (New England Biolabs, Cat. No. S1425S) were added to the supernatant and incubate overnight at 4 degree Celsius ...
-
bioRxiv - Cell Biology 2019Quote: ... 5-10 µg of total protein (9 µl of lysate) were treated with Endo Hf (New England Biolabs) for 1 h at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 40 μl of filtered double-distilled water and 20 μl of Blue Protein Loading Dye (New England Biolabs) were added to the beads ...
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant fusion proteins were purified via affinity chromatography from bacterial extracts using amylose resin (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... σA-FLAG and RbpA-FLAG proteins were prepared by PCR using Q5® High-Fidelity DNA Polymerase (NEB) with primers #3130 + #3131 (HelD) ...
-
bioRxiv - Microbiology 2021Quote: ... A small fraction of the refolded MBP-ACE2NTD fusion protein was further purified by amylose magnetic beads (NEB) according to the protocol provided by the manufacturer.
-
bioRxiv - Molecular Biology 2021Quote: ... EcoRI sites underlined) and different concentration of recombinant His-SET8 protein (0 to 1.4 μM, New England Biolabs) were incubated for 10 min on ice in 1× GRB binding buffer [20 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Microbiology 2022Quote: ... 1-20 μg of the Env protein was mixed with 1 μl of Glycoprotein Denaturing Buffer (NEB, 10×) and H2O (if necessary ...
-
bioRxiv - Cell Biology 2022Quote: ... residual ATP from the protein preparation was depleted using apyrase by mixing 4.5 µl of 500 nM protein with a 0.5 µl of apyrase (NEB), and incubating for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were resolved on SDS-PAGE gels alongside a Blue Protein Standard Broad Range ladder (New England BioLabs). Bands were transferred onto nitrocellulose membranes and were blocked with a 5% (w/v ...
-
bioRxiv - Cell Biology 2024Quote: ... one of the immunoprecipitated samples was treated with 400 units of Lambda protein phosphatase (New England Biolabs, P0753S) at 30 °C for 30 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... the Gbait and dld gRNAs were combined at 4.8uM each with 20uM Lba Cas12a protein (New England Biolabs) and incubated for 10 minutes at 370C ...
-
bioRxiv - Molecular Biology 2023Quote: NSD1/2 WT and different cancer mutants (3.4 μM) were mixed with recombinant H3.1 protein (1 μg) (purchased from NEB) or recombinant H3.1 mononucleosomes in methylation buffer (50 mM Tris/HCl ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.27 nmol ErCas12a/LbCas12aU protein and 0.45 nmol crRNA were assembled in 1 X Nuclease Reaction Buffer (NEB). The protein and RNA were mixed and incubated for 10 minutes at room temperature and used for transformation of embryogenic C ...
-
bioRxiv - Biochemistry 2023Quote: ... and then deglycosylated and dephosphorylated overnight at 37 °C with the protein deglycosylation mix II (New England Biolabs) and Quick CIP (New England Biolabs) ...
-
bioRxiv - Genetics 2023Quote: Total protein extracts were prepared with 2.106 cells re-suspended in 50 μL of loading buffer (B7709S, Biolabs) containing 1% SDS ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified sgRNAs targeting tlnrd1 and slc45a2 were pooled separately and complexed with recombinant Cas9 protein (New England Biolabs) in vitro using 300mM KCl buffer for 5 minutes at +37°C ...
-
bioRxiv - Microbiology 2023Quote: ... E protein glycosylation status was determined by treating RVP lysates with PNGase F (Cat#P0704S, New England Biolabs) for 3 hours at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The proteins were purified using the amylose resin affinity purification method by following the manufacturer’s recommendations (E8021L, NEB). Briefly ...
-
bioRxiv - Biophysics 2021Quote: ... the SNAP-tag fragment was digested from the pSNAP-tag (T7)-2 vector (New England Biolabs), inserted into pET-28b plasmid resulting in a construct referred as pET-SNAP ...
-
bioRxiv - Cell Biology 2019Quote: ... the HeLa cells were kept in HeLa culture media treated overnight with 0.2 U/mL of □2-3,6,8,9 Neuraminidase (New England Biolabs) to cleave sialic acid from the cell surface glycans.
-
bioRxiv - Cell Biology 2020Quote: ... and 2) the insert and pcDNA5-FRT-TO were digested with 40U of EcoRV-HF (NEB) and 40U of XhoI (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... peak fractions pooled and reacted with 2-molar excess SNAP-substrate Alexa-488 dye (S9129, NEB) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were harvested and resuspended in 0.5ml cold 1.2x NEB Buffer 2 (New England Biolabs), incubated with 0.3% SDS for 1 hr at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl 2X Quick T4 ligase buffer and 2 μl Quick T4 DNA ligase (NEB, M2200L) were added to the reaction and incubate at 37 °C for overnight ...