Labshake search
Citations for New England Biolabs :
2301 - 2350 of 4045 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated with 4 μM SNAP-Cell TMR-Star (New England Biolabs S9105) or SNAP-SiR647 (New England Biolabs S9102 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 4 µg of each sample was reverse transcribed using dT priming with Protoscript II (NEB, M0368L) and subsequently treated with 0.5 µL each of Rnase H and Rnase A (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant was loaded on a 10-mL chitin column (NEB). The column was washed with HEGX ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 u/μL T4 DNA ligase (stock 400 u/μL, NEB). No difference in yield was found between the ligation splints ...
-
bioRxiv - Molecular Biology 2021Quote: ... were then combined with 10 μM CLIP-Biotin (New England Biolabs) and rotated (end-over-end ...
-
bioRxiv - Developmental Biology 2022Quote: ... in HBSS supplemented with 10 µg/ml DNase (New England Biolabs) at 37°C and swirled at 100 rpm for 32 minutes to enzymatically separate the epithelium from the mesenchyme as we previously did [47] ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of 10 U/μL T4 PNK (New England Biolabs), 4 μL of 3 U/μL NEB T4 DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Genomics 2019Quote: ... 10 µL T4 RNA ligase 2 truncated (200 U/µL, NEB) was added ...
-
bioRxiv - Microbiology 2019Quote: ... with the addition of 10 μg of BSA (New England BioLabs). The PCR reaction was incubated at 95°C for 3.5 minutes with 30 cycles of 30 s at 95.0°C ...
-
bioRxiv - Genetics 2020Quote: ... supplemented with 10 μl Proteinase K (800 U/ml, NEB #P8107), and incubated at 55°C for 14-18h while shaking at 800rpm ...
-
bioRxiv - Cancer Biology 2019Quote: ... 10 μL of 400 U/μL T4 DNA Ligase (NEB, M0202), and 660 μL of water ...
-
bioRxiv - Microbiology 2019Quote: ... 10 uL NEBNext Q5 Hot Start HiFi Master Mix (NEB M0543L), 0.2X final concentration SYBR Green I ...
-
bioRxiv - Developmental Biology 2020Quote: ... and transformed into NEB 10-beta Competent E.coli (NEB, Ipswich, MA). Colonies positive for the Lgals3-R200S allele by PCR were grown overnight at 37 °C with nutation at 200 rpm ...
-
bioRxiv - Genomics 2019Quote: ... 10 µL of 400 U/µL T4 DNA Ligase (NEB, M0202), and 660 µL of water ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µL of 400 U/µL T4 DNA Ligase (NEB, M0202), and 660 µL of water ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µM Rad51 and 10 µM (nucleotide) φX174 circular ssDNA (NEB) were mixed in reaction buffer C (30 mM Tris-HCl [pH 7.5] ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 10 μl NEBNext 2x High-Fidelity Master Mix (New England Biolabs), 0.3 μM of each primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... coli K-12 DH10B (Neb 10-beta, NEB catalogue no. C3019H), E ...
-
bioRxiv - Microbiology 2020Quote: ... and the assembly reaction used to transform E.coli (NEB 10 beta). Colonies positive by PCR screening using primers that flank the cloning site were sequenced across the entire S coding region and a single positive isolate adopted for all further manipulations.
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 units/µL T4 RNA Ligase 2 (truncated K227Q, NEB). The ligation reaction was incubated for 3 hours at 22 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 µL of the PhD library (1011 pfu, New England Biolabs) is added onto dispersed flakes and incubated for 3 hours on a rotator at room temperature and then washed twice before overnight incubation ...
-
bioRxiv - Biochemistry 2022Quote: ... the plasmid coding for segment 10 was linearized with BsaI (NEB), and the plasmids coding for the remaining segments were linearized using BsmBI (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (#P0756S, New England Biolabs) for 30 min in RT.
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL 10 mM ATP (New England BioLabs; Ipswitch, MA, USA), 10 units T4 RNA Ligase 1 (New England BioLabs ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 U/mL of M-MuLV Reverse Transcriptase (NEB, M02553L) was added to each sample and incubated for 1 hr at 42°C ...
-
bioRxiv - Microbiology 2019Quote: ... and 10 pmol of thermostable 5’ App DNA/RNA ligase (NEB) in 10-μl reaction volume ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 10 mM ribonucleoside vanadyl complex (RVC; New England Biolabs, S1402S) for 10-20 minutes in a 37°C water bath ...
-
bioRxiv - Microbiology 2021Quote: Escherichia coli (NEB® 10-beta Electrocompetent E. coli or NEB® 5-alpha Competent E ...
-
bioRxiv - Biophysics 2019Quote: ... 70 µL Millipore water and 10 µL T4 DNA ligase (NEB) were added to the hybridization reaction and incubated for 60 min at 20 °C.
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10 μg/mL) and apyrase (25 mU/mL, NEB); the suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Nb35–His (10 µg/ml) and apyrase (25 mU/ml, NEB). The suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... and 10 mM ribonucleoside vanadyl complex (New England Biolabs, Ipswich, MA), 10 minutes in 4% paraformaldehyde (Ted Pella ...
-
bioRxiv - Microbiology 2021Quote: ... cells were incubated with 10 μl of DNaseI (New England Biolabs) for 5 min at room temperature before 450 μl of LB was added ...
-
bioRxiv - Immunology 2020Quote: ... 10 μL of OneTaq Quick-Load 2X Master Mix (NEB # M0486L) was used for all colony PCR ...