Labshake search
Citations for New England Biolabs :
2101 - 2150 of 3826 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 10 units of T7E1 (New England Biolabs, Inc., Ipswich, MA) were added to the appropriate tubes ...
-
bioRxiv - Genetics 2023Quote: ... 10 ng of a 1kB Plus DNA ladder (N3200; NEB) was included on either side of the Southern as a size reference ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by supplementation with 10 μl 10X PNK buffer (NEB), 1 μl 0.1 M DTT ...
-
bioRxiv - Microbiology 2023Quote: ... after which 1 μL 10 mM dNTPs (New England BioLabs) were added and reactions incubated at 60 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and 10 U of T4 Polynucleotide Kinase (New England Biolabs) in a final reaction volume of 15 μl at 37°C for 1.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 16 μl of 10× rCutSmart buffer (NEB, no. B6004S) for 30 min at 37 °C ...
-
bioRxiv - Genetics 2023Quote: ... falciparum DNA were performed using 10 U SacI-HF (NEB), 5 U StuI (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... followed by transformation into 10-beta competent cells (NEB, C3020) using the Gemini X2 machine (BTX) ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µMnt ldsDNA (NEB, PhiX RF I digested with ApaLI) was added to initiate the strand exchange reaction ...
-
bioRxiv - Biophysics 2023Quote: ... 8 mM ATP and 10 units of T4 ligase (NEB) were incubated overnight at 16°C ...
-
bioRxiv - Immunology 2023Quote: ... 10 μL of 5x HF Buffer (NEB, cat. no: M0530L), 2.5 μL of 10 μM m-alpha-RC1 primer ...
-
bioRxiv - Systems Biology 2023Quote: ... 1000 μL of 10 × T4 DNA Ligase Reaction Buffer (NEB), 50 μL of 20 mg/mL BSA (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... All injection mixes included 10% phenol red (New England Biolabs) for tracing of injection mix ...
-
bioRxiv - Genomics 2023Quote: ... 120 μL 10 × NEB T4 DNA ligase buffer (NEB B0202), 100 μL of 10% Triton X-100 ...
-
bioRxiv - Immunology 2023Quote: ... 10 μL of 5x HF Buffer (NEB, cat. no: M0530L), 1 μL of 10 mM dNTPs (Promega ...
-
bioRxiv - Immunology 2023Quote: ... 1 μL of 10 mM ATP (NEB, cat. no: M0204S), 1 μL of 10 μM M13 Ligation primer ...
-
bioRxiv - Immunology 2023Quote: ... 10 μL of 5x HF Buffer (NEB, cat. no: M0530L), 5 μL of SYBR Green (1:50) ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 10 µl of MNase (NEB, cat. no. M0247S), and incubated in ThermoMixer C (Eppendorf ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μL of DNA polymerase I (10 U/μL, NEB) and 0.5 μL RNase H (2 U/μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 μl 10× Template Switching RT Enzyme Mix (NEB) were added to the mixture and the reaction was incubated at 42 °C for 90 min followed by 85 °C for 5 min ...
-
bioRxiv - Immunology 2024Quote: ... we electroporated 100 µl of NEB 10-beta (NEB, #C3020K) in a BioRad electroporator using the preset E ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Illumina sequencing adaptor ligation (New England BioLabs, E6000B- 10). Libraries were then indexed and PCR amplified (10 cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 ng of a 1kB Plus DNA ladder (NEB, Cat.N3200) was included as a size reference ...
-
bioRxiv - Synthetic Biology 2024Quote: ... commercial 10-beta competent cells (New England Biolabs, Ipswitch, MA) were transformed with plasmids carrying a canvas repeat sequence-targeting sgRNA cassette driven by strong constitutive promoter apFAB36 [21] ...
-
bioRxiv - Genomics 2024Quote: ... 10 µg of DNA were digested with BamHI (60U, NEB) overnight ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL of M.TaqI (10 units/µL; New England Biolabs) and ultrapure water in a total volume of 40 µL ...
-
bioRxiv - Genomics 2024Quote: ... we added 10 µL of DpnII (NEB, 50 U/μl) and continued the incubation until the end of the day when another 10 μl DpnII was added to each sample to digest overnight ...
-
bioRxiv - Immunology 2024Quote: ... 0.2 mM dNTPs at 10 mM each (New England Biolabs), 1 µM of forward primers total ...
-
bioRxiv - Immunology 2021Quote: ... and ROI 2 were amplified from C57BL/6 genomic DNA by PCR using the Q5® High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA). PCR products were ligated into pSCB-Amp/Kan using the StrataClone Blunt PCR Cloning Kit (Agilent Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 µM of the 6-kb fragment was incubated with 1 unit/µL terminal deoxynucleotidyl transferase (TdT, New England Biolabs, MA, USA, #M0315S) and 0.5 mM deoxyadenosine triphosphate (dATP ...
-
bioRxiv - Genomics 2023Quote: ... 2-8 µg of HMW DNA was diluted in 1x CutSmart Buffer and 6 µl of Quick CIP enzyme (New England Biolabs, catalog no. M0508) was added followed by incubation of the reaction at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... the purified products are treated with Klenow fragment (3’ → 5’ exo-) (Cat. No. M0212L; NEB; use 1 uL) and Taq DNA polymerase (Cat ...
-
bioRxiv - Neuroscience 2021Quote: NFIB 3’ UTR and 5’ UTR HP forming regions were in vitro transcribed using T7 transcriptase (NEB, E2040) and purified with Trizol extraction (described in RT-qPCR paragraph) ...
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... This fragment was generated by a standard 3-step PCR protocol using Phusion DNA polymerase (New England Biolabs) and then cloned into the XbaI and HindIII sites of pEX18A (Prentki and Krisch ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fragmented RNA was then subjected to RNA 3’ linker ligation using T4 RNA Ligase I (New England Biolabs) and reverse transcription using a primer complementary to the linker sequence and SuperScript III (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Bioengineering 2020Quote: ... and the 3’ extension were ligated together into the digested vector using Quick Ligase or T4 Ligase (NEB) to generate the complete pegRNA plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... Ten microliters of PCR products were digested with Nsi1 (3 hours with 5 units of Nsi1 enzyme (NEB)) and then ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Immunology 2021Quote: ... we modified the plasmid using primers EpMap_1 and EpMap_2 along with ssODN EpMap1_ssODN (Extended Data Table 3) using the NEBuilder Mastermix (NEB, E2621S) following the manufacturer’s instructions in order to create hairpin-free overlap regions that could be used for homology-based library cloning ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2020Quote: ... was added at 3’end of RA5) was ligated to RNA using T4 RNA ligase (New England Biolabs) at 25°C for 6 hr and 22°C for 6 hr ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... and cloned between 300 bp of PCR amplified DNA fragments of the LdBPK_250018100.1 5’ and 3’ UTR using NEBuilder (NEB) inside pUC19 for construct amplification in E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Promoters (Supplemental Figure 1, Supplemental Table 3) were amplified from genomic DNA using Q5 polymerase (New England Biolabs) and inserted between the enhancer and 24xMS2 sequences using restriction enzyme-mediated ligation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Homology arms and exon 3 of the murine Akr1b3 locus were amplified with Q5 polymerase (New England Biolabs) using genomic DNA from mouse R1 ES cells (23) ...