Labshake search
Citations for New England Biolabs :
2251 - 2300 of 4022 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 6 U Bst 2.0 WarmStart DNA polymerase (NEB), and 2.25 U WarmStart® RTx Reverse Transcriptase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U/ml Thermolabile proteinase K (NEB). The barcoded PAAm beads were prepared for encapsulation as previously described (Zilionis et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 6 μl of 50% PEG 8000 (NEB B1004A), 40 units of Ribolock RNase inhibitor EO0382)] ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µL of Proteinase K (New England Biolabs) was added to the cell resuspension ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μL GlycoBuffer 2 10X (NEB), 2 μL NP-40 ...
-
bioRxiv - Systems Biology 2021Quote: Rho libraries were amplified using primers MO574 and MO575 (Supplementary file 6) for 6 cycles at an annealing temperature of 66C followed by 18 cycles with no annealing step (NEB Phusion) and then purified with the Monarch PCR kit (NEB) ...
-
bioRxiv - Systems Biology 2022Quote: ... 100ng of vector backbone and 20ng of trcrRNA-CaptureSeq-5’LTR(truncated) cassette were combined with 10 μl of NEBuilder HiFi DNA assembly master mix (NEB cat. no. E2621L) and water to 20 μl ...
-
bioRxiv - Plant Biology 2019Quote: ... A portion of leaf tissue (approximately 5 mm2) was homogenized by grinding in 50 μL of 1X Q5 reaction buffer (New England Biolabs Cat. No. B9027S) in a 1.5 mL microcentrifuge tube with a micropestle ...
-
bioRxiv - Microbiology 2020Quote: ... followed by the addition of 5 μl of UDG reaction solution (New England Biolabs, 0.02 U μl−1 UDG in 1X UDG buffer) and an additional 30 min incubation at 37 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... a non-adenylated 3’ adapter was ordered for chemical synthesis from IDT™ and adenylated with the 5’ DNA Adenylation Kit (New England Biolabs® Inc.) (see Supplemental Table 4 for primers and adapters used) ...
-
bioRxiv - Cancer Biology 2020Quote: ... A 3’ A overhang was added to the ends of the blunted DNA fragment with Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments was then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Physiology 2022Quote: ... in zebrafish f5 proximal promoter sequences (Fig. 4E, Supplemental Table 5) (28) was conducted using a Q5 site-directed mutagenesis kit (NEB, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was slowly cooled down to room temperature with a Δ -1°C / second gradient and 0.5 μl of each RNase H (NEB, 5 U/μl), RNase T1 (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA (2.5 μL) was amplified in two multiplexed PCR reactions using Q5 Hot-Start DNA High-fidelity Polymerase (New England Biolabs, Ipswich, MA, USA) using the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... Each sample was analyzed in duplicate 10-µl reactions containing 5 µl Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA), 2 µM of each primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... a volume of 0.5 µl of the respective restriction enzyme BbsI (5 units; ThermoFisherScientific, Waltham, US) or BsaI-HF®v2 (10 units; New England Biolabs, Ipswich, US) and then 1 µl (1-3 units ...
-
bioRxiv - Microbiology 2020Quote: ... of which 5 μl was processed with the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (New England Biolabs) with previously published modifications to the manufacturers protocol 37 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... cDNA (2.5 μL) was amplified in two multiplexed PCR reactions using Q5 Hot-Start DNA High-fidelity Polymerase (New England Biolabs, Ipswich, MA, USA) using the following cycling conditions ...
-
bioRxiv - Genomics 2021Quote: ... followed by with a buffer adapted from (5-9) consisting of 0.1% (1mg/mL) BSA (New England Biolabs, Ipswich, MA, Item No. B9000S) / 0.3% Igepal CA 630 (Sigma-Aldrich ...
-
bioRxiv - Physiology 2022Quote: ... The single stranded cDNA was ligated with a partial Illumina 5’ adaptor (HZG885:/5phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTddC) using T4 RNA ligase 1 (New England Biolabs, Ipswich, MA, US) and incubated overnight at 22 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... ssDNA standards were generated from PCR products amplified with a forward primer that was 5’ phosphorylated to promote Lambda exonuclease digestion of that strand (NEB, Cat. No. M0262S) and a reverse primer with phosphorothioate bonds between the first four 5’ nucleotides to block digestion ...
-
bioRxiv - Microbiology 2024Quote: ... The initial dephosphorylation reaction was in a mixture (50 μL) containing 5 μL of terminal transferase buffer (NEB Tdt Reaction Buffer, Catalog # M0315S), 1 μL of shrimp alkaline phosphatase (rSAP ...
-
bioRxiv - Microbiology 2024Quote: ... The initial dephosphorylation reaction was in a mixture (50 μL) containing 5 μl of terminal transferase buffer (NEB Tdt Reaction Buffer, Catalog # M0315S), 1 μL of shrimp alkaline phosphatase (rSAP ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were resuspended in 1 ml of iCLIP lysis buffer B (same as buffer A but with 1% v/v NP-40 and 11 μl of Murine RNase inhibitor (NEB) per 1 ml ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 1500-3000 bp of the 3’ coding sequence of each gene was amplified from RH genomic DNA and cloned into the pTKO2-HPT-3xHA plasmid (11) using either Gibson Assembly (NEB) or by cloning into the EcoRV and NotI restriction sites.
-
bioRxiv - Microbiology 2021Quote: ... and cloned to the C terminus of a 11 His-tagged maltose-binding protein in a pMAL-C5X vector (New England Biolabs) separated by a cleavage site for tobacco etch virus protease ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was performed for 7-11 cycles (depending on input DNA concentration) using NEBNext Mulitplex Oligos (New England Biolabs). Indexed sample concentration was quantified using the KAPA Library Quantification Complete Kit (Universal)(Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification of transposon-genome junctions was performed using the cycling parameters described in the kit for 11 cycles with Q5 Ultra II FS Master Mix (NEB) using primers YL006 (AGCGGCAATTTCACACAGGA ...
-
bioRxiv - Microbiology 2023Quote: ... and JSW-SS-34:41 (AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN TCGTCGGCAGCGTC) to amplify libraries for 11-13 cycles using Phusion High Fidelity PCR Master Mix (NEB) instead of the Illumina-supplied PCR reagents ...
-
bioRxiv - Plant Biology 2024Quote: ... and rbcS-E9 enhancers and the synthetic enhancers syn1–11 were cloned upstream of the 35S minimal promoter in pDL by Golden Gate cloning using BsaI-HFv2 (NEB). The synthetic enhancers were ordered as synthesized DNA fragments.
-
bioRxiv - Genomics 2024Quote: ... The ATAC libraries were amplified for 11 cycles using NEBNext 2X MasterMix and Nextera Index primers (New England Biolabs, # M0541S). The amplified libraries were size selected using AMPure beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the random primer method (Random Primer 6, NEB S1230S ...
-
bioRxiv - Biochemistry 2019Quote: ... and terminated by adding 6× DNA loading buffer (NEB). For cleavage assay presented in Figs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 µl of the dissolved cells were added to a 50 µl PCR reaction (Q5 DNA polymerase, NEB; see Table S2 for primer sequences) and amplified with 36 rounds of thermal cycling ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA (400 ng) was either mock digested (i.e. without enzyme addition) or digested with BglII (New England Biolabs, 5 units/rxn, NEBuffer 3.1) for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2020Quote: ... A total of 12 sRNA libraries were constructed from 5 μg of size-selected RNA using the NEBNext® Small RNA Library Prep kit (New England Biolabs, Ipswich, MA, USA) as per the manufacturers’ instructions ...
-
bioRxiv - Biophysics 2019Quote: ... The resulting product (typically 50 – 100 μL of 5 – 20 μM of protein) was mixed with an equimolar amount of SNAP-Surface 549 (New England Biolabs; 1 mM in DMSO) and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... After addition of 200 µl nuclease elution mix (NEB nuclease P1 buffer 1 x, MgCl2 5 mM, 0.5 µl NEB nuclease P1, 0.5 µg benzonase) samples were incubated over night at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 100 ng purified linear vector fragments were assembled with 5 µl of annealed oligonucleotide pool using NEBuilder HiFi DNA Assembly (New England Biolabs, Ipswich, MA, USA, #E2621L) according to the manufacturer instructions ...
-
bioRxiv - Genomics 2022Quote: ... and for the synthesis of the second strand of cDNA was used the Klenow fragment 3’-5’ exo (New England Biolabs Inc., Ipswich, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Proximity barcode ligations were carried out in 150 µl T4 ligation reaction mix (11 µL T4 ligase (NEB cat# M0437B-BM), 75 mM Tris pH 7.5 ...
-
bioRxiv - Genetics 2020Quote: ... PMO-induced alternative splicing of ush2a transcripts was analysed by PCR amplification using primers in zebrafish ush2a exon 11 using Q5 HF DNA polymerase (New England Biolabs, #M0491L). Primer sequences are provided in table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... Crude and purified proteins were further analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and its molecular weight (Broad range 11 to 245 kDa, BioLabs, England) was determined [14].
-
bioRxiv - Genomics 2021Quote: ... Tagmented DNA fragments were amplified by adding 12 µL PCR master mix composed of 11 µL Q5 High-Fidelity 2x Master Mix (New England Biolabs, #M0492) and 0.5 µL each of 10 mM Nextera i5 and i7 index primers ...
-
bioRxiv - Cell Biology 2021Quote: ... on a Mini Gel Tank (Thermo #A25977) using MES SDS Running Buffer (Thermo #B0002) alongside broad range markers (11-245KDa, NEB #P7712S). Each lane contained 20 μg of protein ...
-
bioRxiv - Immunology 2022Quote: ... Caspase-11 catalytic (C254A) and cleavage (D285A) mutants were generated by site-directed mutagenesis (Q5 SDM Kit, New England BioLabs; #E0554S) of the wild-type parent vector according to manufacturer’s instructions ...