Labshake search
Citations for New England Biolabs :
2101 - 2150 of 4022 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified with the oligonu-cleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit (5 μg) user manual (NEB #T1030). Purified PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
bioRxiv - Biophysics 2021Quote: ... to obtain a 1080 bp long DNA with 5 bp overhang and was subsequently dephosphorylated with Antarctic phosphatase (NEB, catalog #M0289S). The obtained product was PCR purified using Qiagen PCR purification kit ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Molecular Biology 2022Quote: pGEMHE plasmid constructs (Supplementary Table 2A) were linearized and 5’-capped mRNA was synthesized with T7 polymerase (NEB HiScribeT7 ARCA kit) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Specific sRNAs were detected by hybridization with DNA oligonucleotides labeled at their 5’ termini with [γ-32P]ATP and T4 Polynucleotide Kinase (New England Biolabs) as previously described (Ibrahim et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All but 5 µl of this product was then diluted 20x into a PCR reaction that consisted of 1x Taq buffer (NEB, B9014), 1 mM MgCl2 ...
-
bioRxiv - Microbiology 2019Quote: ... An RNA adaptor (5’ GACCUUGGCUGUCACUCA-3’) was ligated to the 5’-monophosphate of the RNA end by incubation with T4 RNA ligase (NewEngland BioLabs, Inc.), at 25°c for 16 h ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA bound to Gag was first dephosphorylated at the 5’ end with calf intestinal alkaline phosphatase (New England BioLabs, NEB) followed by T4 polynucleotide kinase-catalyzed (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: DNA oligonucleotides 308 and 310 were 5’-radiolabeled with [γ-32P] ATP (Perkin-Elmer) using T4-polynucleotide kinase (New England Biolabs). Radiolabeled nucleotides were then purified by electrophoresis in a 12% native polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products (donor-5’biotin, donor-unmodified) were gel purified using the Monarch DNA Gel Extraction Kit (New England Biolabs, T1020S) and eluted in 20μl embryo transfer water (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Colony PCRs were carried out in 12.0 μL final volumes containing: 5 μL of high-fidelity OneTaq® QuickLoad® 2X Master Mix (New England Biolabs), appropriate forward and reverse control primers (both 0.4 μM ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... chromatin and chromatin bound fractions were released from magnetic beads using binding buffer containing 5 mM CaCl2 plus an excess (2000 units/ 20 mL reaction) of micrococcal nuclease (MNase; NEB, M0247S) Beads were incubated for 5 minutes at 37 °C with shaking (1250 rpm) ...
-
bioRxiv - Biochemistry 2020Quote: Mutagenesis of the 5-HT2C construct was performed according to the Q5® site-Directed Mutagenesis Kit protocol (New England BioLabs). In brief ...
-
bioRxiv - Cell Biology 2019Quote: ... were performed with 5-10 μM final protein concentration and 10 μM dye (SNAP-Surface Alexa Fluor488 (New England Biolabs S9129S) or SNAP-Surface Alexa Fluor647 (New England Biolabs S9136S) ...
-
bioRxiv - Cell Biology 2019Quote: 40pmol of single stranded oligonucleotide was labelled at the free 5’-OH group with 20 units of T4 polynucleotide kinase (NEB # M0201) in a 50 μl reaction volume containing 1X polynucleotide kinase buffer and 30 μCi γ32P ATP at 37°C for 30min ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The Nested PCR product (5 μl) was digested with NciI restriction enzyme at 37°C for 15 min (New England Biolabs, USA). The final digested DNA fragments was resolved in 2.5 % gel electrophoresis stained with ethidium bromide and visualized with Bio-Rad gel doc XR (Molecular Imager ...
-
bioRxiv - Biochemistry 2021Quote: ... at 37 °C for 1 hour or first with 5 units T4 Polynucleotide Kinase with 25 mM ATP in 1 X T4 Kinase buffer (T4PNK, NEB, M0236S) at 37 °C for 30 min and then with XRN-1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... were heated to 65°C and slow-cooled to 37°C before reverse transcription with 5 U AMV-RT (NEB, M0277L) at 42°C for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Genomics 2022Quote: ... chromatin was digested overnight at 37°C with the addition of 25 μL 10X NEBuffer2 and 100U (5 μL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62°C to inactivate the HindIII ...
-
bioRxiv - Cell Biology 2020Quote: A synthetic miR-409-5p oligo was 5’ end-labelled with γ-P32 ATP using T4 polynucleotide kinase (New England Biolabs) and purified using G-50 columns ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Immunology 2021Quote: ... were generated by introducing the corresponding amino acid mutations (Extended Data Fig. 5) using the Q5® Site-Directed Mutagenesis Kit (NEB) and per manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... and sequencing adaptors (5 μl) from the Ligation Sequencing Kit (ONT, #LSK109) and Quick T4 DNA Ligase (10 μl) (NEB, M2200S) were added to the cleaved and dA-tailed gDNA sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 µl of this DNA mixture and 2.5 µl of UltraPure water was added to 5 µl of NEBuilder® HiFi DNA Assembly Master Mix (NEB E2621) on ice ...
-
bioRxiv - Genomics 2019Quote: To prepare the RNA sample for use in a smallRNA library preparation kit the sample was phosphorylated using 5 ul of 10X T4 PNK buffer and 1 ul of T4 PNK (NEB #M0201), 1 ul of SUPERASE-In ...
-
bioRxiv - Developmental Biology 2022Quote: ... The regulatory sequences of Crbn were PCR amplified from genomic DNA (primers in Supp Table 5) and cloned into a pCESA vector upstream of H2BGFP coding sequences using the restriction enzymes AscI and NotI (NEB England). Mutations into the Snail binding motif of the Crbn regulatory sequences were obtained by recombination using NEBuilder (NEB England ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were washed 3 times with PBS and permeabilized 5 min on ice with permeabilize sol (1xPBS, 1%RNAse inhibitor Ribovanadylcomplex (RVC, NEB,#S1402S), 0,5 % Triton X-100 (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 pmol dephosphorylated RNA was 5’ phosphorylated with 32P from γ-32P ATP (Hartmann Analytic) with T4 PNK (New England Biolabs) in 1x PNK buffer in a 20 μl reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Toe-printing reactions were carried out in 5-µl aliquots containing a PURExpress transcription-translation coupled system (New England Biolabs, USA) to which the test template was added (16) ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of the enzyme was used in the 50 μl-reaction containing 5 μl of rCutSmart Buffer (10X, NEB # B6004S) for 30 min-incubation at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... blunt DNA fragments on the beads were adenine-tailed by adding 7μl of Klenow 3’→5’ exo-polymerase 5U/μl (New England Biolabs cat. #M0212L), 2.3μl of dATP 10mM and 5 μl NEB2 of 10x NEBuffer 2 and incubating the mixture 30 minutes at 37ºC and a further 10 minutes at 65ºC to inactivate the enzyme.
-
bioRxiv - Genetics 2022Quote: ... ds-DNA was constructed from two oligos that are annealed and 5’ overhangs filled in using Klenow polymerase according the manufacture’s specifications (NEB cat. M0210L). All yeast transformation were carried out using the lithiumacetate method ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by treatment with DNase I.5 The samples were then purified with the Monarch® RNA Cleanup Kit (New England Biolabs).
-
bioRxiv - Genomics 2022Quote: ... PCR amplification was carried out by addition of 5 µL 10 µM Nextera index mix(Vazyme, #TD203) and 25 µL Q5 High-Fidelity 2X master mix (NEB, #M0492S) to the 20 µL sample ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting double-stranded oligos had 5’ extensions that were complementary to the non-palindromic 3’ overhangs generated by BsaI-HFv2 (NEB, R3733) digestion of pJJW101 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction underwent ethanol precipitation as described above and the precipitated DNA was suspended in 32 μl Elution buffer and used in a 50 μl A-tailing reaction using Klenow (3’→5’ exo-) (NEB, M0212), incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Genomics 2022Quote: ... 1500 calcein-stained cells in 5 μL of were added to 35 μL of barcoded hydrogel templates with 29 U/mL Proteinase K (NEB #P8107S) and 70 mM DTT (Sigma #D9779 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’ ends of RNA fragments were phosphorylated by T4 PNK and ligated to 5’ adaptor (CGATCTCCAATTCCCACTCCTTTCAAGACCTrC) using T4 RNA Ligase 1 (NEB, M0437M). Ribosomal RNA (rRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... A 13 nt RNA oligonucleotide was radiolabeled at the 5’ end with [γ-32P] ATP and T4 polynucleotide kinase (New England Biolabs) prior to EC assembly ...
-
bioRxiv - Bioengineering 2024Quote: ... The splitGFP plasmid was amplified using primers 53 and 54 to install 3’ stop codon and primers 55 and 56 to install the 5’ stop codon using Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles ...
-
bioRxiv - Immunology 2024Quote: ... Insert and vector were combined at a 5:1 ratio and held at 50 °C for 1 hour in NEBuilder® HiFi DNA Assembly Master Mix (NEB). Gibson assembly products were purified using the MinElute® PCR Purification Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The tube containing the plugs was then cooled to 42°C before adding 5 µl of Beta-Agarase I (New England Biolabs, M0392) and incubating at 42°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was then returned to ice for 5 minutes before 180 μL of NEB® 10-beta/Stable Outgrowth Medium (B9035, NEB) was added ...
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).