Labshake search
Citations for New England Biolabs :
2201 - 2250 of 4022 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cell lysates were adjusted to the same protein concentration using furin cleavage buffer (100 mM Tris-HCL and 1mM CaCl2) and incubated with 5 units of Furin (NEB, Ipswich, MA) for 16 h at 30℃ ...
-
bioRxiv - Microbiology 2022Quote: ... colony PCR was conducted to amplify the 5’ IGR of the major T6 cluster using OneTaq DNA Polymerase (New England Biolabs – MA, USA). PCR products were confirmed with gel electrophoresis and Sanger sequencing by Eton Bioscience Inc ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Plant Biology 2021Quote: ... 500 ng of the SAP-treated RNA was treated with 12.5 units RNA 5’ Pyrophophohydrolase (RppH; New England BioLabs; Ipswitch, MA, USA) in 1X T4 RNA Ligase Buffer (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... with 1% (w/v) octylglucoside containing 5 U endoglycosidase H (Endo H) or peptide: N-glycosidase F (PNGase F; both NEB, Frankfurt, Germany) at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... and transformed into competent DH5a E. coli (5-alpha Competent E. coli) following the protocol provided by the company (New England Biolabs, Ipswich, MA). For colony selection ...
-
bioRxiv - Molecular Biology 2020Quote: Thermocycler was used to denature and anneal 5 µl of PCR product as recommended by manufacturer (EnGen™ Mutation Detection Kit, NEB, E3321S). Thermocycler was adjusted for heteroduplex formation as following ...
-
bioRxiv - Genetics 2019Quote: ... 2× 1-5 µg of DNA were adaptor ligated and indexed using the NEBNext DNA library Prep Reagent Set (New England Biolabs: E6040S/L) and NEBNext Multiplex Oligos for Illumina Primer sets 1 (New England ...
-
bioRxiv - Microbiology 2019Quote: ... 20 µl of template, 20 U of exonuclease I, 5 U of Antarctic phosphatase, 1× Antarctic phosphatase buffer; New England Biolabs, Frankfurt, Germany); incubation conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 uL of the Gibson Assembly reaction mixture was transformed via heat shock into chemically competent NEB 5-alpha cells (NEB, Catalog #C2988J), and cells were incubated on lysogeny broth with 10 μg/mL tetracycline (LB-Tet10 ...
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were then 3’dephosphorylated by denaturing at 65°C for 5 min and incubating with T4 PNK (NEB, catalog no. M0201S) in a 10 μL reaction (7 μL precipitated RNA ...
-
bioRxiv - Microbiology 2021Quote: ... and total of 5 μg of the five fragments was ligated in an equal molar ratio by T4 DNA ligase (New England Biolabs, Ipswich, MA) at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: Vector pFLD was digested with PmlI at 37°C for 2 h and dephosphorylated with 5 U Antarctic phosphatase at 37 °C for 30 min as recommended by the manufacturer (NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Microbiology 2021Quote: ... 39 μl of each lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units ...
-
bioRxiv - Bioengineering 2022Quote: Reunion of 4-6 nM of dsDNA template (gblocks® Gene Fragment, IDT) to a solution of 5 U/μL of T7 RNA polymerase (NEB, M0251), 200 nM Cas9 (S ...
-
bioRxiv - Biochemistry 2022Quote: ... and the impurities that were tagged by Chitin Binding Domain were extracted on a gravity-flow column using 5 mL Chitin resin (New England BioLabs, Evry, France). The target proteins were purified with HisTrap HP columns (GE Life Sciences ...
-
bioRxiv - Genomics 2022Quote: ... we amplified a 150 bp sequence using primers pGL3-CDC20_F and pGL3-CDC20_R (Phusion High-Fidelity PCR Master Mix, NEB M0531, Supplemental Table 5) that added restriction sites for SacI and XhoI to the 150 bp sequence ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was A-tailed with Fermentas Klenow 3′ to 5′ exonuclease (Cat# EP0421) and ligated with adaptor oligonucleotides (NEB NEXT adaptor oligos) using Mighty Mix Ligase (Cat# TAK6023) ...
-
bioRxiv - Microbiology 2024Quote: ... A repair template plasmid carrying the ∼1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard HYGR cassette inserted between the two flanks ...
-
bioRxiv - Microbiology 2024Quote: ... 39 μl of each benzonase-treated lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1 μl (400 units ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... before being incubated in 5% normal goat serum dissolved in PBS-TX (NGS-PBS-TX; NGS; New England BioLabs, Hitchin, Hertfordshire, UK) for a minimum of one hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were propagated in Escherichia coli NEB Turbo ((F’ proA+B+ lacIq ΔlacZM15/fhuA2 Δ(lac-proAB) glnV galK16 galE15 R(zgb-210::Tn10) TetS endA1 thi-1 Δ(hsdS-mcrB)5)) (New England Biolabs) at 37°C in lysogeny broth (LB ...
-
bioRxiv - Microbiology 2023Quote: ... and amplified with the primers (5’-CAA GAC TAG TGG AAG CGG AGC TAC TAA CTT CAG CCT GCT GAA GCA GGC TGG CGA CGT GGA GGA and 5’-NNN NAC GCG TCT AGC CTT CCC AGA CGT ACC C) using high-fidelity Phusion polymerase (NEB, Cat# M0530S). The PCR fragment was digested with BmtI and MluI ...
-
bioRxiv - Genetics 2023Quote: ... One microliter of T-tailed DNA adaptors diluted to 1.5 µM in water was added to 5 µl of amplicons diluted to 1/10 in water and 5 µl of 2X Blunt/TA Ligase Master Mix (New England Biolabs, Herts, UK) and incubated 30 min at 25°C for ligation ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Molecular Biology 2023Quote: In vitro transcribed RNAs were treated with Antarctic phosphatase (Fermentas, Waltham, MA) to remove the 5’ terminal phosphate and then labeled by T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA) in the presence of γ-32P-labeled ATP (PerkinElmer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting fragment was subjected to error-prone PCR under the following conditions: 5 U of Taq DNA polymerase (New England Biolabs, MA, USA), 200 μM of each deoxynucleoside triphosphate ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The amplicons were purified and subjected to error-prone PCR under the following conditions: 5 U Taq DNA polymerase (New England Biolabs, MA, USA), 200 μM of each deoxynucleoside triphosphate ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’ adapters with 4 terminal randomized nucleotides at the 3’ end was added using T4 RNA ligase (New England Biolabs, cat# M0204S). Ligation was carried out for 1 hour at 25°C with 20% PEG8000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a 5’ phosphorylated 3’ end adapter featuring 4 randomized nucleotides at the 5’ terminus and a 3’ blocking group (3C Spacer; 3SpC3, IDT) underwent adenylation using Mth RNA ligase (New England Biolabs, cat# M2611A). Adapters were subsequently ligated to deacylated and demethylated RNA templates using a truncated KQ T4 RNA ligase 2 (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... 6 µg of DNA was used for MmeI digestion in 200 µL (6 µg gDNA, 6 µL MmeI (2000 U/mL, NEB), 0.5 µL 32 mM S-adenosylmethionine ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A fraction (6 μL) of the eluate was mixed with an equal volume of 6× purple gel loading dye (NEB) and loaded in 1% agarose gel with ethidium bromide ...
-
bioRxiv - Immunology 2023Quote: ... was biotinylated with sulfosuccinimidyl-6-[biotinamido]-6-hexanamido hexanoate (sulfo-NHS-LC-LC biotin; ThermoScientific) and coupled to streptavidin beads (New England Biolabs). Patient samples were incubated with RBD-coupled beads and excess sera washed off with PBS (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and PCR addition of indices (7-11 cycles) was done using NEBNext Ultra II DNA library prep kit (NEB). Biotinylated capture probes 70 nt in length were designed against every DpnII restriction fragment in a 2.5 Mb window centered on Runx1 (chr16:91,566,000-94,101,999) ...
-
bioRxiv - Genomics 2019Quote: ... and 6 μl USER enzyme (New England Biolabs). The reaction was incubated at 37°C for three hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 6 μl 10mM ATP (New England Biolabs). Linear DNA was then digested by 30 minute incubation at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 6 μl 20 mg/ml BSA (NEB B9000S), and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L) ...