Labshake search
Citations for New England Biolabs :
2251 - 2300 of 3328 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... which was purified directly over Monarch DNA Cleanup Columns (5 μg) (New England Biolabs) using a 10:1 ratio of binding buffer (a modified version of Qiagen’s PB buffer ...
-
bioRxiv - Genomics 2024Quote: ... RNAs were 5’dephosporylated through 90 minutes incubation in total with thermostable QuickCIP (NEB) in which the samples were briefly heated to 75°C and quickly chilled on ice at the 60 minutes mark ...
-
bioRxiv - Genetics 2024Quote: ... along with an additional 5 µL 2x Gibson Assembly Master Mix (NEB Cat#E2611L). The reaction mixture was incubated at 50°C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs, E6111L), and 0.25 uL of mRNA Second Strand Synthesis enzyme (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... with 5 μL Quick-Load pBR322 DNA-MspI Molecular Marker (New England Biolabs Inc.) in a separate lane ...
-
bioRxiv - Biochemistry 2024Quote: ... The assembly reaction was transformed into NEB 5-alpha competent cells (New England Biolabs). After the recovery step ...
-
bioRxiv - Molecular Biology 2024Quote: ... Coverslips were then washed twice for 5 min in 1x rCutSmart buffer (NEB; #B6004S) and once in 1x blunting buffer (NEB ...
-
bioRxiv - Genetics 2024Quote: ... Dangling ends were removed by a 5 min incubation with Exonuclease III (NEB #0206) at 37 °C and biotin enrichment was done using 20 ul DynabeadsTM MyOneTM Streptavidin C1 beads (Invitrogen #65001) ...
-
bioRxiv - Microbiology 2024Quote: 5’ RACE was done using a Template Switching (TS) Reverse Transcriptase Enzyme mix (NEB) that takes advantage of a template switching reverse transcriptase and a template switching oligonucleotide (TSO) ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli 5-alpha and purified using the Monarch Plasmid Miniprep Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2024Quote: ... and fragment inserts were cloned into digested pLS21-5 using Gibson assembly (NEB, E5510S). The plasmid pARL01 ...
-
bioRxiv - Neuroscience 2024Quote: ... Each PCR reaction was subsequently supplemented with 5 μL of CutSmart Buffer (NEB B7204) and digested using 1μL DpnI restriction enzyme (NEB R0176 ...
-
bioRxiv - Genomics 2024Quote: ... we added 5 pg of unmethylated DNA from phage λ (New England Biolabs, E7123A) per 10 ng sample DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... for 30 minutes and the supernatant mixed with 5 mL Chitin Resin (NEB #S6651), previously washed first with 30 mL of ddH2O and then 20 mL of HEGX buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-10 μg of plasmid was linearised with the restriction enzyme NotI (NEB, R3189L). The linearised plasmids were run on a gel to ensure complete digestion ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Transformations used the NEB recommended protocols for chemical transformation (NEB 5-alpha, Cat# C2987H) or electroporation (NEB 10-beta ...
-
bioRxiv - Bioengineering 2024Quote: ... digested vec-tors were treated with 5 units of Antarctic Phosphatase (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2024Quote: ... The purified plasmid DNA (5 µg) was incubated with T4 DNA ligase (NEB, M0202) (2.5 µL ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Constructed plasmids were transformed and maintained in NEB 5-alpha (New England Biolabs (NEB) C2987H ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Constructed plasmids were transformed and maintained in NEB 5-alpha (New England Biolabs (NEB) C2987H ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL NEB T4 DNA Ligase from the NEB Quick Ligation Module (NEB, E6056), and 1.0 μL Native Adapter (NA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then immediately added 5 µL of a solution with 1X Ligase Buffer (NEB), 0.75 mM ATP (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genomics 2024Quote: ... 4 µg of each sample was reverse transcribed using dT priming with Protoscript II (NEB, M0368L) and subsequently treated with 0.5 µL each of Rnase H and Rnase A (Thermo Fisher ...
-
bioRxiv - Genetics 2024Quote: ... Plugs were then equilibrated in NEBuffer 4 and treated with 75 U of exonuclease T (NEB) for 90 min at 24 °C.
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM UTP and 1 mM GTP and 4 mM ARCA (Anti-Reverse Cap Analog) (NEB)) ...
-
bioRxiv - Biochemistry 2024Quote: ... Alkaline phosphatase treatment was performed over night at 4°C using Lambda Protein Phosphatase (#P0753S, BioLabs).
-
bioRxiv - Cell Biology 2020Quote: ... RNase H treatment on fixed cells was performed using 5 U RNase H (M0297, NEB) for 3 h at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: 5-7 μg of HiC library in a total volume of 100 μl (1x NEB buffer 2.1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... a set of 5’-end biotinylated anti-sense DNA oligoes and 5ul RNase inhibitor (NEB) were added to the lysate ...
-
bioRxiv - Molecular Biology 2020Quote: ... oligonucleotides were 5-end labeled with 32P-γATP using T4 polynucleotide kinase (New England Biolabs). Supercoiled pUC19 plasmid dsDNA was prepared by a method that did not involve DNA denaturation (Clewell and Helinski ...
-
bioRxiv - Molecular Biology 2021Quote: 5’ RACE was performed using the Template Switching RT Enzyme Mix (New England Biolabs M0466) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2021Quote: Decapping of 5 µg total RNA was performed with 200 units of yDcpS (NEB M0463S) in 10mM Bis-Tris-HCl pH 6.5 ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...