Labshake search
Citations for New England Biolabs :
2051 - 2100 of 3328 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Parental plasmids were digested by adding 5 µL 10x cutsmart buffer (NEB), and 1 µL DpnI (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA substrates were 5’ terminally labelled with T4 Polynucleotide Kinase (NEB, M0201S) and ATP-γ-32P (PerkinElmer ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-end radiolabeled DNA was generated with T4 polynucleotide kinase (M0201L, NEB) and [γ-32P]ATP (NEG035C005MC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 20-200 nM pppUGAAUG hexamer standard ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.6 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 15% PEG ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μg 5’PPP transcripts were incubated with 10 U RppH (NEB) and 20 U RiboLock (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Each 5 uL of the reaction contained 0.5 uL of ATP (NEB), 0.5 uL DTT (1 mM final concentration) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of isolated AAVs were treated with DNAse I (NEB, M0303S) before preparing ten-fold serial dilutions ...
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Zoology 2023Quote: ... 5 µl consisting of 1x OneTaq® PCR master mix (NEB, USA), 0 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH, NEB). The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’ ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% (v/v) T4 DNA ligase at 400 U/μL (NEB #M0202), 5% (v/v ...
-
bioRxiv - Biophysics 2023Quote: ... 2.5 mM MgCl2 and 5 mM CaCl2) and digested by MNase (NEB) for 5 min at 25°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Eluates containing MBP-fusions were applied to 5 mL amylose resin (NEB) columns and extensively washed with 20 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli competent cells (NEB 5-alpha, New England Biolabs, Ipswich, MA, USA) that were cultured and prepared using a GenElute HP Plasmid Midi kit (NA0200-1KT ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2023Quote: ... or HpaII + PmlI (1x NEB CutSmart Buffer, 5 U enzyme/μg DNA) for 1h at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA was treated with 5 U of Antarctic Phosphatase (NEB #M0289S) for 1h at 37°C in 20 μl reactions ...
-
bioRxiv - Microbiology 2023Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Genomics 2023Quote: ... and 1 µL of Taq Polymerase (5 U/µL, New England Biolabs) to the CIP reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of 10× rCutSmart™ Buffer (New England BioLabs, Ipswich, MA), 10 units each of SalI and EcoRV restriction enzymes (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... before 9 μl of 5 U/μl thermostable RNase H (M0523, NEB) were added and samples were incubated 1 h at 50 °C with 800 rpm shaking (15 s on/15 s off) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 9 μl of 5 U/μl of thermostable RNase H (M0523, NEB) were added and samples were incubated 1 h at 50 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of 2X protein synthesis buffer (New England Biolabs, Beverly, MA), 0.25 μL of RNaseOUT RNAse inhibitor (Thermo-Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixtures were mixed with 5 µl RNA dye (New England Biolabs) and separated by 12% TBE PAGE ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 5’-end phosphorylation with T4 PNK (New England Biolabs, NEB) and simultaneous blunt ligation of the plasmid using T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 5’-end phosphorylation with T4 PNK (New England Biolabs, NEB) and simultaneous blunt ligation of the plasmid using T4 DNA ligase (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting 5’ biotinylated PCR products were digested with BsaI-HF (NEB) to generate four base-pair overhangs ...
-
bioRxiv - Molecular Biology 2023Quote: ... dinucleotide primers were 5’-labeled using T4 polynucleotide kinase (New England Biolabs) and added at 20 µM without pre-annealing to the template ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation of RNA fragments was achieved using T4 Polynucleotide Kinase (NEB) and Adenosine 5’-Triphosphate (ATP ...
-
bioRxiv - Microbiology 2024Quote: ... TdT reaction buffer (1.5 µl), CoCl2 (5 µl, 0.25 mM) (NEB #B0252), and filtered H2O (4.5 µl ...
-
bioRxiv - Genomics 2024Quote: Mix gently and add 5 ul of 20mg/ml proteinase K (NEB) solution to each tube and incubate for 3 hr at 45°C being careful there is no condensation.
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µl of T4 PNK (10,000 U/ml, NEB, cat. no. M0201S), 4 µl of T4 DNA polymerase (3,000 U/ml ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The 25nt RNA was additionally 5’-phosphorylated (T4 PNK 10U/µl NEB) in a total reaction volume of 50µl ...
-
bioRxiv - Systems Biology 2024Quote: ... Each construct was transformed into standard 5-alpha competent bacteria (#C2987; NEB) grown overnight in in 500 ml of standard Luria Broth (LB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were then treated with 5 units of Antartic phosphatase (NEB M0289S) in a final volume of 50 µL for one hour at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... 1 U of Hot Start Taq DNA Polymerase (5 U/μL, NEB), 1X PCR buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 ug of genomic DNA was dephosphorylated using Quick CIP (NEB M0525S) for 30 minutes at 37C ...
-
bioRxiv - Cell Biology 2024Quote: ... with 5 µg/mL restriction enzymes BamHI and NheI (New England Biolabs) according to the manufacturer’s instructions for 1 hour at 37ºC ...
-
bioRxiv - Plant Biology 2020Quote: ... 19 μL binding mixture containing 4 μL nuclear extracts and 5U Rnase H (NEB) or bovine pancreatic RNase A (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... and 10 pmol of each used in a 4-fragment Gibson assembly reaction (NEB) to generate GT10 5’_pSY45_pDS66_GT10cHA3 Flox_GT10 3’_pUC19 ...
-
bioRxiv - Cell Biology 2021Quote: ... the supernatant fraction was incubated with 4 ml amylose resin (New England Biolabs, E8021L) for 1 h ...
-
bioRxiv - Genomics 2022Quote: ... then 4 μl of Q5 High-Fidelity 2X Master Mix (NEB, cat. no. M0541L) was added to each well ...
-
bioRxiv - Genomics 2022Quote: ... the DNA was added to 4.5 μL of 10X NEBuffer 4 (New England Biolabs), uridine diphosphate-6-azideglucose (UDP-6-N3-Glu ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 pmol of each used in a 4-fragment Gibson assembly reaction (NEB) to generate TbGT8 5’_BSDr_TbGT8 3’_pUC19 ...
-
bioRxiv - Genetics 2024Quote: ... 120 μL (4 mg/mL) streptavidin magnetic beads (NEB cat no. 50-812-660) were washed 3 times with 1 mL of lysis buffer then resuspended in 100 μL of complete lysis buffer and added to the hybridization mix and then incubated at 37 °C for an additional 30 min with mixing ...
-
bioRxiv - Microbiology 2023Quote: ... gene marker cassette by overnight ligation at 4 °C with T4 DNA Ligase (NEB). Overnight ligations were transformed into chemically competent DH5ɑ E ...
-
bioRxiv - Microbiology 2023Quote: ... Ligation was performed overnight at 4 °C using T4 DNA ligase (New England Biolabs) followed by heat-inactivation for 10 min at 80 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μL template DNA and 0.4 units of Phusion High-Fidelity DNA Polymerase (NEB) (primer sequences provided in Table S3) ...