Labshake search
Citations for New England Biolabs :
2201 - 2250 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and indexed with NEBNext® Multiplex Oligos for Illumina® (96 Index Primers) (New England Biolabs, Ipswich, Massachusetts, USA). Sample libraries at 1.1 pM were sequenced twice on the NextSeq500 ...
-
bioRxiv - Plant Biology 2021Quote: ... Site-directed mutagenesis primers were designed using NEBasechanger and implemented through Q5® Site-Directed Mutagenesis (NEB, Cat #E0554S). TPL interactor genes were amplified as cDNAs from wild type Col-0 RNA using reverse transcriptase (SuperScript™ IV Reverse Transcriptase ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2017) using primers designed by NEBaseChanger and the Q5 Site-Directed Mutagenesis Kit (New England Biolabs. Cat. No.: E0554S). The mutations were confirmed by DNA sequencing.
-
bioRxiv - Biochemistry 2020Quote: ... was constructed by assembling two fragments amplified from pON106 using two primer pairs (NeoRH1 and P5_A5_reverse, P5_A5_forward and NeoRH2) with Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). Plasmid No ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Bioengineering 2021Quote: ... 50 ng input genomic DNA was first linearly pre-amplified with 10 nM final concentration 5p-CCR5_UMI primer using the Q5 High-Fidelity DNA Polymerase (New England Biolabs): (98 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We engineered the Thrβ119Ser substitution by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The libraries were amplified and both the indexed and universal primer (NEBNext Multiplex Oligos for Illumina, New England Biolabs) were added by PCR using HGS Diamond Taq DNA polymerase (Eurogentec) ...
-
bioRxiv - Systems Biology 2021Quote: ... 3 μL of the reverse phasing primer pool (100 nM) and 15 μL of Q5 Mastermix (New England Biolabs). Cycle conditions were 4 minutes at 98°C followed by 20x (30 seconds at 98°C ...
-
bioRxiv - Immunology 2020Quote: ... Ighγ1 heavy-chain sequences were amplified in a nested PCR using primers for the Ighγ1 constant region together with a specific primer for VH186.2 (Mayer et al., 2017)(Table S1) and using high-fidelity Q5 polymerase (NEB). Amplified products were cloned (CloneJET PCR Cloning Kit ...
-
bioRxiv - Genetics 2020Quote: ... PCR to amplify the barcode for Illumina sequencing was performed on 2.5 µL of isolated DNA (primers listed in Table S1) with Q5 polymerase (NEB), following manufacturer’s instructions with between 25-35 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... ICL3 and S305A mutations were generated using back-to-back primers on pCDNA3.1-HCAR1-Flag vector by Q5 Site-Directed Mutagenesis Kit (NEB). Fluorogen activating peptide fusion to HCAR1 was synthesized with insertion of HCAR1 using BsmI site into pMFAP-β1 vector (Spectragenetics) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... containing the T7 promoter and terminator were amplified using the specific primers (0.25 μM or 0.5 μM) and Phusion® DNA polymerase (NEB). The amplification program was ...
-
bioRxiv - Cancer Biology 2024Quote: ... Specific mutations in human PSEN1 were obtained by Q5 site-directed mutagenesis of the pMSCV-puro vector containing wild type human PSEN1.26 We designed primers for Q5 site-directed mutagenesis (New England Biolabs) with NEBaseChanger.neb.com and performed site-directed mutagenesis according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of isolated phage T4 in Pi-Mg buffer was used as a PCR template in the first PCR with the following reaction mix: 0.125 µM each primer (Supplementary Table 2) in 1x High Fidelity Master Mix (NEB) with a total volume of 10 µl ...
-
bioRxiv - Developmental Biology 2024Quote: A Primer Exchange Reaction concatemerization reaction (1X PBS; 10 mM MgSO4; dNTP, 0.6 mM of A, C, and T, NEB-N0446S ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2.5 μl 25μl p7 custom primer (Buenrostro et al. 2013) and 25 μl NEBNext Ultra II Q5 2x Master Mix (NEB) and a PCR with 10 cycles was conducted as stated in the Omni-ATAC protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total cDNA for RT-qPCR was generated from 1.5 µg total RNA using a random primer mix and M-MuLV reverse transcriptase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... primers oAA033-034 were used to remove mprF using the Q5 site-directed mutagenesis kit (NEB Cat. No. E0554S) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... appropriate fragment of SynPOR gene was amplified with specific primers with additional fragments corresponding to amplified pET15b_AtPORB (Table S2) with Q5 polymerase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Forward and reverse primers (100 µM) were phosphorylated and annealed using T4 Polynucleotide Kinase (PNK; New England Biolabs M0201S) and 10x T4 Ligation Buffer (Thermo B69) ...
-
Deletion of MEC1 suppresses replicative senescence of the cdc13-2 mutant in Saccharomyces cerevisiaebioRxiv - Molecular Biology 2023Quote: ... 2017) using primers designed by NEBaseChanger and the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, cat. no.: E0554S). The mutations were confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2023Quote: ... The primers JA02 GenoF1 (ACAGACGGTTGTTATATTTTGCTCT) and JA02 LOA GenoR (ACTGACTTAATGAATGTCTGACGG) amplicons were digested with (AleI-v2, New England Biolabs). Chil4KD/KD animals have an undigested 405bp band and wild-type animals showing two bands cleaved around 150bp and 250bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... the product was purified using magnetic SPRI beads and amplified using 0.5 µM i5/i7 Illumina indexed primers in Q5 High-Fidelity Master Mix (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were constructed and amplified using 1.25 μM Nextera index primers and NEBNext High-Fidelity 2xPCR Master Mix (New England BioLabs). A quantitative PCR was run to determine the optimal number of cycles ...
-
bioRxiv - Genomics 2022Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) following the manufacturer’s description (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... 200 nM dT adaptor primer and 200 nM Vλ1-GSP4-2-Hind III and 2 U Taq polymerase (NEB), in a final volume of 50 µl ...
-
bioRxiv - Systems Biology 2023Quote: ... A pcDNA3.4 backbone was amplified with specific primers (Fw: GGTAAGCCTATCCCTAACCCTCT, Rv: AGGCGATCTGACGGTTCAC) using NEBNext Ultra II Q5 HotStart (NEB). The library insert and linearized backbone were assembled using the NEBuilder HiFi DNA assembly master mix and half of the reaction volume was transformed by electroporation into 100µL of NEB 10-beta electrocompetent E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting cDNA was PCR amplified using primers A1.MS-SDA-ADDobody-F and tonBtot_R (Table S4) using Q5 DNA polymerase (New England Biolabs) and reactions conditions according to the manufacturer’s recommendations (initial denaturation at 98 °C for 30 s ...
-
bioRxiv - Bioengineering 2023Quote: ... NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (Catalog # E6440, NEW ENGLAND BIOLABS,MASSACHUSETTS, UNITED STATES) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Genomics 2024Quote: M13seq primer (5’-GACGTTGTAAAACGACGGC-3’) was labeled with 32P at 5’-end by T4 polynucleotide kinase (New England Biolabs). Primer/template (p/t ...
-
bioRxiv - Microbiology 2024Quote: ... 3 µL of the reverse phasing primer pool (100 nM) and 15 µL of Q5 Mastermix (New England Biolabs). Cycle conditions were 4 minutes at 98°C followed by 20x (30 seconds at 98°C ...
-
bioRxiv - Microbiology 2024Quote: ... primers TZ-54 and TZ-55 were used to amplify the C-terminus of CapRelSJ46 using Taq polymerase (NEB) and 0.5 mM MnCl2 was added to the reaction as the mutagenic agent ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA was isolated from total RNA using NEBNext Poly(A) mRNA magnetic isolation module (NEB cat# E7490. Primers (below) were designed to recognize the 5’ half of the mRNA ...
-
bioRxiv - Plant Biology 2024Quote: ... we amplified the mTURQUOISE2 gene from vector C440010 using primers FHOx90/FHOx91 and Q5 DNA Polymerase (New England Biolabs) and combined the PCR product with modules pICH47742 ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction (PCR) was performed on a genomic rat DNA template using a Taq PCR Kit (New England Biolabs), and the subsequent PCR product was purified using a Qiagen PCR Purification Kit (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA library yield was increased by a further round of PCR with Post LM-PCR oligos (Nimblegen) and Q5 High-Fidelity DNA polymerase (NEB). The PCR reaction consisted of 30 μl of the mono or di nucleosomal DNA libraries (150270 ng) ...
-
bioRxiv - Genetics 2019Quote: ... Libraries were quantified using a Qubit fluorometer before an 18-cycle PCR amplification on bar-coded fragments with Phusion high-fidelity PCR Kit (New England Biolabs). The PCR products were cleaned using 1X vol of AMPure XP Beads.
-
bioRxiv - Bioengineering 2019Quote: VIM-T2A-mCardinal sequence was cloned from cDNA of knocked-in cells upon PCR amplification into linearized by PCR pmR expressing vector (Clonetech) and recombined using Gibson Assembly reagent (NEB). Resulting vector contained full VIM-T2A-mCardinal reading frame under the control of CMV promoter ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR products were cleaned up using the Monarch® PCR and DNA clean-up kit (New England Biolabs, USA). The PCR samples were mixed with 125 μl of the DNA Clean-Up Binding Buffer ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... of HIV env was amplified using a nested PCR approach with Phusion High-Fidelity PCR Master Mix (New England Biolabs). The outer primers were ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed in 1X Phusion® High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs M0531) and PCR cycling at 98°C for 30s ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed in 20 uL 1X Phusion® High-Fidelity PCR Master Mix with HF Buffer (NEB M0531) and using touchdown PCR cycling at 98°C for 30s ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses were performed using Luna Universal Probe One-Step qRT-PCR Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were gel-purified and used for a second round of PCR amplification (Q5 NEB master mix, 7 cycles) using custom primers to attach Illumina read sequences ...
-
bioRxiv - Microbiology 2020Quote: ... these long gene sequences containing enzyme sites firstly was amplified by common PCR by Q5 high-fidelity PCR kit (Cat: #M0491, NEB), using primer F and R pairs of S or N ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tagmented DNA was amplified with 12 cycles of PCR using the NEBNext Hi-Fi 2X PCR Master Mix (NEB M0541) and unique dual index primers ...
-
bioRxiv - Microbiology 2022Quote: ... The ORF was removed by inverse PCR to generate the genomic deletion vector (P5/P6) and plasmid recircularized from PCR product (KLD enzyme blend, NEB).