Labshake search
Citations for New England Biolabs :
2101 - 2150 of 5258 citations for 6 Chlorotetrazolo 1 5 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Bioengineering 2023Quote: ... for the ligation rounds are added to 96 well plates and their 5’ ends phosphorylated with T4 Polynucleotide Kinase (NEB). After 5’ phosphorylation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of the library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Then ...
-
bioRxiv - Microbiology 2023Quote: ... A second DNA adapter (containing a random-mer of 10 (N10) random bases at the 5′ end) was then ligated to the cDNA fragment 3′ end (T4 RNA Ligase, NEB) in the presence of a high concentration of PEG8000 and dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 μL of ligation reaction mix was prepared (1X ligation buffer, 5 units of T4 RNA ligase I (New England Biolabs), 0.5 μL RNaseOut Ribonuclease inhibitor ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 µl of each PCR product was digested with either 0.5 µl XceI/NspI (for Trim28+/D9; Themo Scientific, FD1474) or 0.5 µl MslI (for Tp53R270H/+; New England BioLabs, R0571L) in a final reaction volume of 30 µl ...
-
bioRxiv - Genomics 2024Quote: ... 1 μg of each sublibrary plasmid was digested at 37°C for 5 hours with NheI-HF and SacI-HF (New England Biolabs), incubated with rSAP for 30 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of primers described in Supplementary Table 7 and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 µCi) ...
-
bioRxiv - Microbiology 2024Quote: The 5’ end of the sigAb transcript was identified using 5’ RACE following manufacturer’s protocol with template switching RT enzyme mix (NEB; M0466). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro RNA transcription was performed in 50 µl reactions: 5 µl RNAPol Reaction Buffer (New England BioLabs, Ipswich, MA), 2 µl T7 RNA Polymerase (New England BioLabs ...
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Biochemistry 2024Quote: ... 1-5 mL of cell pellet was harvested for plasmid extraction with the Monarch Plasmid DNA Miniprep Kit (New England Biolabs) (T1010) ...
-
bioRxiv - Biochemistry 2024Quote: ... When relevant cmpRNA (500 pmol) was 5’-end phosphate-32 “hot” labeled using fresh gamma phosphate-32 labeled ATP (50 nmol) and PNK (NEB) following the producer’s recommendations ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ and 5’ ends were modified accordingly and the respective adapters were ligated with a T4 RNA ligase I (New England Biolabs). The final products were size-selected one last time and rRNA depletion was performed using custom-made biotinylated oligos(38 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 (49) and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Physiology 2024Quote: ... 5 flies were sorted into sterile microcentrifuge tubes and homogenised in 200 µl lysis buffer (1 X TE, 1 % Triton X-100, 1/100 proteinase K (NEB, P8107S)) using a mechanical pestle ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μL of Disulfide Bond Enhancer 1 and 1 μL of Disulfide Bond Enhancer 2 (New England Biolabs Cat No. E6820S). The reactions were incubated at 37 °C for 8 hours and used immediately or stored at -80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 1:1 combination of oligodT 18 primers and random hexamers (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl 10× T4 PNK buffer and 1 μl T4 PNK enzyme (NEB) at 37 °C for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... 120 nM fluorescent beacon and 1 U.μL-1 murine RNase Inhibitor (NEB M0314) in the reaction buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of BsaI-HFv2 and 1 μl of T4 DNA ligase (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... RNase H diluted (1:100) in 1× RNase H buffer (New England Biolabs) was added to the cells and incubated for 2 h at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was further adjusted with dTTP (1 µl, 1 mM) (NEB #N0443S), TdT reaction buffer (1 µl) ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μl of DNAse I at 1 mg/ml (NEB, cat no. M0303L), 1 μl RNAse at 10mg/ml (NEB ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the resulting cell pellet was resuspended in 1 mL of RNA Protection Buffer (1× NEB DNA/RNA Protection Reagent, 1% (w/v) polyvinylpyrrolidone-40 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 0.5 µl of 1 mg mL−1 purified bovine serum albumin (1:20 dilution in dH2O of BSA, Molecular Biology Grade 20 mg ml−1, NEB cat. B9000), 0.25 µl of T4 DNA ligase at 400 U µL−1 (NEB cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Genomics 2020Quote: ... Biotin was removed at 20°C for 4 hours in a 50 μL reaction for every 5 μg of DNA using 15 units of T4 DNA polymerase (NEB, M0203L) and 25 nM dATP and 25nM dGTP in NEBuffer 3.1 (no dTTP and dCTP) ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Developmental Biology 2021Quote: ... A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified with the oligonucleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit 5 µg user manual (NEB #T1030). Clean PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Physiology 2019Quote: ... 5’-TGTGCTGAGAAAACGCAGGT-3’ and sgRNA2: 5’-TGTCAACTGAAGGACCCAAG-3’) The template sequence was transcribed into RNA using a T7 RNA polymerase (New England Biolabs, E2040S) after which the DNA template was removed by treatment with RNase-Free DNaseI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-ACGTACGCGGCCGCAAAATGAGGCTGCACCTGGCGGCGATCC-3’ and 5’-ACGTACTCTAGACTACTCGTGCCACTCGATCTTCTGGGCTTCAAATATGTCATTCA AACCGCCTCCAATTACAAAGGCCGTGATCCAGTCCAGAAACTTGGCC were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing a Drosophila gd cDNA as template ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Genetics 2021Quote: ... Custom inverse complementary adapters that had inverse complementary terminal modifications to ensure unidirectional ligation (3’-T overhang and 5’ phosphorylation) were ligated onto both ends of the respective subsets using the Ultra II Ligation Module (NEB, USA) according to manufacturer’s instructions and purified with 1:1 bead cleanup (Figure 3) ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...