Labshake search
Citations for New England Biolabs :
2351 - 2400 of 5258 citations for 6 Chlorotetrazolo 1 5 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 1 µl PsiI enzyme (NEB), 1 µl EcoRI enzyme (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl EcoRI enzyme (NEB), 1 µl PsiI enzyme (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... 1 µL Phusion polymerase (NEB), and remainder water (to 50 µL) ...
-
bioRxiv - Neuroscience 2023Quote: SOX10 (89356, NEB, 1:400), sox10 zebrafish (AB229331 ...
-
bioRxiv - Neuroscience 2023Quote: ... p21 (2946, NEB, 1:3000), Isl1/2 (67.4E12 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cy3-(1:400, Jackson Biolabs), Alexa 546-(1:400 ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM ATP (NEB, # P0756S), 1 µl Esp3l (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 uL of DpnI (NEB) was added directly to the PCR reactions for 1 hr at 37°C ...
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 1 (NEB), 5 μL of PNGaseF (500 U/μL ...
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 1 (NEB). Following incubation ...
-
bioRxiv - Biophysics 2024Quote: ... A 1 kbp ladder (NEB) was used for the relative comparison of the bands.
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 1 (NEB).
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 mM dNTPs (NEB #N0447L), 250 nM of the first primer (IDT ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 mM dNTPs (NEB #N0447L), 250 nM of the first primer (IDT ...
-
bioRxiv - Microbiology 2024Quote: ... 1 x adenylation buffer (NEB), and 1 mM ATP ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2x 1-5 µg of DNA were adaptor ligated and indexed using the NEBNext DNA library Prep Reagent Set (New England Biolabs: E6040S/L) and NEBNext Multiplex Oligos for Illumina Primer sets 1 (New England ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Genetics 2021Quote: ... the poly (A) product was broken into pieces at 94 °C for 5-7 min using the Magnesium RNA Fragmentation Module (NEB, MA, USA). The RNA fragments were then reverse-transcribed using the SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cell lysates were adjusted to the same protein concentration using furin cleavage buffer (100 mM Tris-HCL and 1mM CaCl2) and incubated with 5 units of Furin (NEB, Ipswich, MA) for 16 h at 30℃ ...
-
bioRxiv - Microbiology 2022Quote: ... colony PCR was conducted to amplify the 5’ IGR of the major T6 cluster using OneTaq DNA Polymerase (New England Biolabs – MA, USA). PCR products were confirmed with gel electrophoresis and Sanger sequencing by Eton Bioscience Inc ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Plant Biology 2021Quote: ... 500 ng of the SAP-treated RNA was treated with 12.5 units RNA 5’ Pyrophophohydrolase (RppH; New England BioLabs; Ipswitch, MA, USA) in 1X T4 RNA Ligase Buffer (New England BioLabs ...
-
bioRxiv - Physiology 2021Quote: ... and 72 °C for 5 min) using a Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) and primers containing the restriction sites of SpeI or BglII for subsequent subcloning (F ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and transformed into competent DH5a E. coli (5-alpha Competent E. coli) following the protocol provided by the company (New England Biolabs, Ipswich, MA). For colony selection ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Molecular Biology 2020Quote: Thermocycler was used to denature and anneal 5 µl of PCR product as recommended by manufacturer (EnGen™ Mutation Detection Kit, NEB, E3321S). Thermocycler was adjusted for heteroduplex formation as following ...
-
bioRxiv - Genetics 2019Quote: ... 2× 1-5 µg of DNA were adaptor ligated and indexed using the NEBNext DNA library Prep Reagent Set (New England Biolabs: E6040S/L) and NEBNext Multiplex Oligos for Illumina Primer sets 1 (New England ...
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 uL of the Gibson Assembly reaction mixture was transformed via heat shock into chemically competent NEB 5-alpha cells (NEB, Catalog #C2988J), and cells were incubated on lysogeny broth with 10 μg/mL tetracycline (LB-Tet10 ...
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were then 3’dephosphorylated by denaturing at 65°C for 5 min and incubating with T4 PNK (NEB, catalog no. M0201S) in a 10 μL reaction (7 μL precipitated RNA ...
-
bioRxiv - Microbiology 2021Quote: ... and total of 5 μg of the five fragments was ligated in an equal molar ratio by T4 DNA ligase (New England Biolabs, Ipswich, MA) at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: Vector pFLD was digested with PmlI at 37°C for 2 h and dephosphorylated with 5 U Antarctic phosphatase at 37 °C for 30 min as recommended by the manufacturer (NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Microbiology 2021Quote: ... 39 μl of each lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units ...
-
bioRxiv - Cancer Biology 2022Quote: ... to remove the 3’-phosphate group from the uncharged tRNA followed by ligation to 5’-adenylated uniquely barcoded adapters using RNA ligase 2 truncated KQ (New England BioLabs, Cat. # M0351L). The resulting tRNAs were then ligated to a 5’-adaptor ...
-
bioRxiv - Bioengineering 2022Quote: Reunion of 4-6 nM of dsDNA template (gblocks® Gene Fragment, IDT) to a solution of 5 U/μL of T7 RNA polymerase (NEB, M0251), 200 nM Cas9 (S ...
-
bioRxiv - Biochemistry 2022Quote: ... and the impurities that were tagged by Chitin Binding Domain were extracted on a gravity-flow column using 5 mL Chitin resin (New England BioLabs, Evry, France). The target proteins were purified with HisTrap HP columns (GE Life Sciences ...
-
bioRxiv - Genomics 2022Quote: ... we amplified a 150 bp sequence using primers pGL3-CDC20_F and pGL3-CDC20_R (Phusion High-Fidelity PCR Master Mix, NEB M0531, Supplemental Table 5) that added restriction sites for SacI and XhoI to the 150 bp sequence ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was A-tailed with Fermentas Klenow 3′ to 5′ exonuclease (Cat# EP0421) and ligated with adaptor oligonucleotides (NEB NEXT adaptor oligos) using Mighty Mix Ligase (Cat# TAK6023) ...