Labshake search
Citations for New England Biolabs :
2051 - 2100 of 2459 citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: A total reaction volume of 25μL consisting of 12.5μL of One Taq® 2X Master Mix (New England Biolabs), 0.2 μL of DNA template (< 1000 ng) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 ng RNA were used for analysis with the LUNA one-step RT-qPCR kit (LUNA E3005L Biolabs). The relative expression levels of the mRNA of interest were determined by real-time PCR using Quantifast SYBR Green Mix (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: ... The RT-PCR detection was conducted by using the Luna Universal One-Step RT-qPCR kit from NEB and following its protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Regions of interest were amplified by PCR using a One-Taq Hot Start DNA-polymerase (New England Biolabs) with standard buffer and 3% DMSO and the following primers targeting exon2 (L ...
-
bioRxiv - Microbiology 2022Quote: ... Detection of selected targets was performed with Luna® Universal One-Step RT-qPCR (New England BioLabs Inc.) according to manufacturers protocol using specific primers ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of DNA template in 25 µl of 1x One Taq Standard Buffer (Biolabs, Ipswich, MA, USA), 0.2 mM dNTPs ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA was then directly used in the Luna® Universal One-Step RT-qPCR Kit (New England BioLabs). Primers listed in supplemental table 10.
-
bioRxiv - Cell Biology 2024Quote: ... one of the immunoprecipitated samples was treated with 400 units of Lambda protein phosphatase (New England Biolabs, P0753S) at 30 °C for 30 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... one cell stage zebrafish embryos were injected with 50 nM EnGen® Lba Cas12a (Cpf1) (New England Biolabs) and each gRNA at a final concentration of 2 nM ...
-
bioRxiv - Microbiology 2023Quote: Plasmid DNA containing one copy of the SIV gene was linearized using EcoR1 (New England Biolabs, Ipswich, MA) following their restriction digest protocol (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA synthesis and qRT-PCR were performed simultaneously using the Luna Universal One-Step RT-qPCR kit (NEB) with the Quantstudio 7 Flex (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA synthesis and RT-qPCR was carried out using Luna® Universal One-Step RT-qPCR Kit (NEB) according to the manufacturer’s instructions with 100 ng of mRNA ...
-
bioRxiv - Bioengineering 2023Quote: ... cloning was achieved via one-pot restriction-ligation reactions with type IIS restriction enzymes (NEB or Thermo Scientific) and T4 DNA ligase (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... RNA expression levels were quantified using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs #E3005L) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Microbiology 2023Quote: PCR was carried out using NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs, E3006) or Taqman Fast Universal PCR master mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% glycerol) and one time with molecular grade water followed by incubation with proteinase K (New England Biolabs) at 55 °C for 30 minutes with constant shaking ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% glycerol) and one time with molecular grade water followed by incubation with proteinase K (New England Biolabs) at 55 °C for 30 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... Polyadenylated transcripts were purified using oligo d(T)25 magnetic beads (New England Biolabs). RNA was dephosphorylated using FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: PBMCs were co-emulsified with oligo d(T)25 magnetic beads (New England Biolabs) in lysis buffer (100mM Tris pH 7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were incubated with 20 μl Oligo d(T)25 Magnetic Beads (NEB, S1419S) in PCR strips for selection of polyadenylated (poly(A) ...
-
bioRxiv - Genomics 2024Quote: ... Poly(A) mRNA was selected using Oligo d(T)25 Magnetic Beads (NEB, S1419S) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: PBMCs were co-emulsified with oligo d(T)25 magnetic beads (New England Biolabs) in lysis buffer (100 mM Tris pH 7.5 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... total DNA from one clone was isolated using the Monarch Kit for HMW DNA Extraction from Bacteria (NEB#T3060) and confirmed by Nanopore sequencing.
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using Luna Universal One-Step RT-qPCR kit (New England Biolabs, Ipswich, MA, USA) according to manufacturer’s protocol using Agilent Mx3000P instrument ...
-
bioRxiv - Microbiology 2022Quote: ... Five microliters of the mixture was added to Luna Universal Probe One-Step RT- qPCR mixture (NEB, MA, USA) to a final volume of 20 µl ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned using one unit each of Exonuclease I and Antarctic Phosphatase (New England Biolabs, Massachusetts, USA), with sequencing reactions performed using an ABI3730 Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... The membrane fraction was then incubated with one of the three deglycosylation enzymes: O-Glycosidase (New England Biolabs, #P0733), PNGase F (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Poly(A) RNA was isolated using one round of selection with oligo(dT)25 magnetic beads (New England Biolabs). This resulted in approximately 10 μ g of poly(A ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µl was added to a 9 µl Luna® Universal One-Step RT-qPCR reaction (NEB, Cat# E3005L). RT-qPCR was carried out to manufacturer specifications in a CFX96 Touch Real Time PCR Machine (Bio-Rad) ...
-
bioRxiv - Plant Biology 2020Quote: ... 100ng of each entry and destination vector are assembled in one reaction mix containing 10U BsaI-HF-v2 (NEB), 200U T4 Ligase (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (M300, New England Biolabs). The samples were analyzed using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... using the IP4 set of primers and probe as described on the WHO website (https://www.who.int/docs/default-34source/coronaviruse/real-time-rt-pcr-assays-for-the-detection-of-sars-cov-2-institut-35pasteur-paris.pdf?sfvrsn=3662fcb6_2) and the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs, France).
-
bioRxiv - Microbiology 2020Quote: ... RNA was subjected to OneStep qRT-PCR analysis using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) or Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... One sample was left untreated and the other two were supplemented with 1X Protein MetalloPhosphatase buffer (New England Biolabs) and 1 mM MnCl2 only or together with 1 μl Lambda Protein Phosphatase (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... 10°C hold in one cycle) by adding 25 µl of 2X PCR master mix (New England Biolabs, M0541S) and 0.8 µl of Ad 2.X reverse primer ...
-
bioRxiv - Biophysics 2022Quote: The long DNA linkers containing a 5’ overhang on one end and digoxigenin on the other end were prepared by PCR 68,69 using Q5 polymerase (NEB). Lambda phage DNA (Thermofisher ...
-
bioRxiv - Biophysics 2022Quote: ... The two primers are annealed and the single strand overhangs are filled in using One-Taq DNA polymerase (NEB). These filled-in primers are then amplified by PCR with One-Taq DNA polymerase (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed in 384 well format with Luna Universal Probe One-Step RT-qPCR Kit (NEB), assaying Fluc (primers oHR711/712 ...
-
bioRxiv - Microbiology 2020Quote: ... SCV2 RNA was quantified using a NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs, E3006) and 2019-nCoV CDC N1 primers and probes (IDT ...
-
bioRxiv - Biophysics 2021Quote: DNA assembly one-step multiple fragment cloning technique (NEBuilder HiFi DNA assembly cloning kit, E5520, New England Biolabs, MA). We ligated the assembled products into a pXS2 plasmid [84] using the pXS2.Pex13.2 [85] plasmid (gift from Meredith Morris ...
-
bioRxiv - Cell Biology 2022Quote: ... 100ng of each entry and destination vector are assembled in one reaction mix containing 10U BsaI-HF-v2 (NEB), 200U T4 Ligase (NEB) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... PCR were performed using Q5 PCR master mix and One-Taq quick load master mix for colony PCR (NEB), primers were purchased from IDT (Louvain ...
-
bioRxiv - Developmental Biology 2019Quote: ... single copy scGESTALT.2 F1 male transgenic adults were crossed to wildtype female adults and one-cell embryos were injected with 1.5 nl of Cas9 protein (NEB) and sgRNAs 1-8 in salt solution (8 µM Cas9 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR were performed using Q5 PCR master mix and One-Taq quick load master mix for colony PCR (NEB), primers were purchased from IDT (Louvain ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCR was conducted in technical triplicate using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to the manufacturer’s instructions in 10 µl reaction volumes and reactions were run on a CFX Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was diluted with one volume of water and treated with 0.5 μL of 20 mg/mL proteinase K (New England Biolabs) at 50°C for 2 hours ...
-
bioRxiv - Microbiology 2020Quote: ... THUNDERBIRD Probe qPCR Master Mix (Toyobo) for MERS-CoV and Luna Universal Probe One-Step RT-qPCR Kit (NEB) for SARS-CoV-2.