Labshake search
Citations for New England Biolabs :
2001 - 2050 of 2459 citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The amplified PCR product was digested in one step using NdeI and BamHI HF (New England Biolabs) and ligated into similarly treated pET-15b to create plasmid pET15b-EcGhrA ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR kit (New England Biolabs; #E3005L). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... One μg of RNA was used to prepare cDNA using the LunaScript RT SuperMix (New England Biolabs). cDNA was then diluted 10-fold and 1 μL was used per qRT-PCR reaction ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and IFIH1 were quantified using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs #E3005L) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Enzymes for the one-step isothermal assembly were purchased from New England BioLabs (NEB, Ipswich, MA, USA). PCR were performed using Q5 PCR master mix and One-Taq quick load master mix for colony PCR (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Enzymes for the one-step isothermal assembly were purchased from New England BioLabs (NEB, Ipswich, MA, USA). PCR were performed using Q5 PCR master mix and One-Taq quick load master mix for colony PCR (NEB) ...
-
bioRxiv - Plant Biology 2020Quote: ... The one-step cDNA synthesis was carried out using LunaScript™ RT SuperMix Kit (NEB Biolabs, USA) followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... The one-step cDNA synthesis was carried out using LunaScript™ RT SuperMix Kit (NEB Biolabs, USA) followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... one PCR product amplified from gBlock1 (JEP1862+JEP1863) and pMS26 digested with NotI using NEBuilder Hifi (NEB). pMTP114 was constructed by assembling two PCR products amplified from F plasmid (JEP1398+1340 and JEP1341+1399 ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and selection cassette (either NeoR or HygroR) were assembled in one reaction using NEBuilder HiFi kit (NEB) in pMK289 backbone [3] ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using the Luna universal one-step RT-qPCR kit (#E3005, New England Biolabs) according to the provided protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 12.5 µl of One Taq Quick-load 2x master mix with standard buffer (New England BioLabs, UK) was aliquoted into a DNase-free 0.2ml transparent PCR tube ...
-
bioRxiv - Microbiology 2022Quote: pJJW101 derivatives containing one of the four NT ospA-targeting sgRNAs were cut with BglI (NEB, R0143), dephosphorylated with Quick-CIP (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2.5𝜇L of each primer (Where each reaction had non-barcoded primer "Ad1_noMix" and one barcoded primer ’Ad2.1’ - ’Ad2.9’ added) and 25𝜇L NEBNext High-Fidelity 2x PCR Master Mix (NEB) and was run under the following conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... annealed into double stranded sgRNA oligos and cloned into LentiCRISPRv2 plasmid using one step BsmBI (NEB #R0580) digestion and T4 ligase (NEB #M0202S ...
-
bioRxiv - Microbiology 2023Quote: ... Transcript levels of individual genes were determined by the Luna Universal One-Step RT-PCR kit (NEB) using approximately 100-200 ng of total RNA per sample as input ...
-
bioRxiv - Molecular Biology 2023Quote: ... All qRT-PCR reactions were performed with the Luna Universal One-Step RT-qPCR kit (E3005 NEB) according to manufacturer protocol with a few modifications ...
-
bioRxiv - Immunology 2023Quote: ... expression levels were determined using the Luna Universal One-Step RTqPCR kit (New England Biolabs catalog #E3005X) per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: RT-qPCR experiments were performed with the Luna® Universal One-Step RT-qPCR Kit (NEB, #E3005E) with a final reaction volume of 10 μL per well ...
-
bioRxiv - Microbiology 2023Quote: ... and RpoD control were assessed using the Luna Universal One-Step qRT-PCR kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... thermocycler with the Luna Universal one-step qPCR Master Mix (E3005; New England Biolabs, Ispwich, MA, USA). Amplification reactions for genes of interest were performed in 50 cycles of the following cycling protocol ...
-
bioRxiv - Microbiology 2023Quote: We performed RT-qPCR on select genes using the Luna Universal One-Step Kit (New England Biolabs) and QuantStudio 5 (Thermo) ...
-
bioRxiv - Molecular Biology 2023Quote: ... each gDNA sample was divided into two and one aliquot was digested with StyI-HF (NEB, R3500S). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 ng of total RNA was used with Luna Universal One-Step RT-qPCR (NEB, Ipswich, MA) to detect StayGold mRNA expression ...
-
bioRxiv - Genomics 2020Quote: ... mRNA was enriched with Oligo d(T)25 Magnetic Beads (New England Biolabs) and fragmented by heating at 94 °C for 3 min in 5× First Strand Buffer (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 15 µl of Oligo d(T)25 Magnetic Beads (S1419S, New England Biolabs), were combined with 50 µl of binding buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... pGEMHE-DEST containing TaHKT1;5-D was linearized using sbfI-HF (New England Biolabs) before synthesising cRNA using the mMESSAGE mMACHINE T7 Kit (Ambion ...
-
bioRxiv - Genomics 2021Quote: ... samples were incubated with 20 μl Oligo d(T) Magnetic Beads (NEB, S1419S) in PCR strips for selection of polyadenylated (poly(A) ...
-
bioRxiv - Genomics 2021Quote: ... mRNAs were incubated with Oligo d(T) Magnetic Beads (New England BioLabs S1419), then fragmented in 2x Superscript III first-strand buffer (Thermo Fisher Scientific with 10mM DTT (Thermo Fisher Scientific 18080044 ...
-
bioRxiv - Genomics 2022Quote: ... mRNA was isolated using Oligo d(T)25 Magnetic Beads (New England Biolabs) and fragmented ...
-
bioRxiv - Genomics 2022Quote: ... mRNAs were enriched by incubation with Oligo d(T) Magnetic Beads (NEB, S1419S) and then fragmented/eluted by incubation at 94°C for 9 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold and the cleavage products were resolved by native 1.2% agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2020Quote: ... 6 units of T4 DNA polymerase and 400 units of T4 DNA ligase (NEB) were then added and the reaction was incubated at 12°C for 1 hour to allow second strand synthesis ...
-
bioRxiv - Genomics 2021Quote: ... The decapped RNA was Recapped with 6 μL Vaccinia Capping Enzyme (VCE) (NEB, #M2080) in 1X VCE reaction buffer (50 mM Tris HCl ...
-
bioRxiv - Plant Biology 2019Quote: ... 6 μg of DNA was digested with restriction enzyme EcoRI (New England Biolabs, USA). Digested DNA was separated on 0.8% agarose gel and blotted onto Hybond-N+ nylonmembrane (Amersham Pharmacia Biotech ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 6 μl primers (10 μM) and 50 μl Q5 high fidelity master mix (NEB). The thermocycling parameters were ...
-
bioRxiv - Molecular Biology 2022Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 6-12 µg of genomic DNA was dephosphorylated with rSAP (NEB), followed by AMPure XP beads purification ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 μg of pure enzyme (RlmJ/RlmF) or BSA (NEB, Ipswich, MA, USA) as a control [27] ...
-
bioRxiv - Bioengineering 2022Quote: One μL of amplicons from colony PCR is mixed with 1 μL of Gel Loading Dye (6x; NEB) and 4 μL of nuclease-free water in each well on the 1.2% agarose gel (Sigma ...
-
bioRxiv - Genetics 2019Quote: ... the product was digested for one hour at 37°C using 40 U EcoO109I (New England Biolabs, USA), 5 µL accompanying buffer solution ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (New England Biolabs). The samples were analyzed using a Lightcycler 480 instrument (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... One of each pair was treated with 0.5 μl of calf intestinal phosphatase (CIP) (New England Biolabs #M0290) before the pair were incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... coli and ligated to one end using Golden Gate assembly with BsmBI and T4 DNA ligase (NEB, Vazyme). All oligos and the corresponding templates used in the cloning for these experiments are outlined in Table S6 ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription and qRT-PCR analysis was performed by Luna universal one- step qRT-PCR kit (NEB # E3005L) with primers list in Table 9.
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Immunology 2021Quote: ... The purified Cxcl1 promoter fragment was equally split into two groups: one treated with M.SssI (New England Biolabs) and the other without M.SssI (“mock” ...
-
bioRxiv - Immunology 2022Quote: ... The qPCR was performed using the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with cycling conditions of 10 min at 55°C for reverse transcription ...
-
bioRxiv - Cell Biology 2019Quote: ... One thousand three hundred micrograms of DNA-free RNA were used for cDNA synthesis with random hexamers (NEB) using SuperScript II (ThermoFisher ...