Labshake search
Citations for New England Biolabs :
2001 - 2050 of 7434 citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... primers containing overhangs of the 3x FLAG peptide were phosphorylated using the T4 polynucleotide kinase (New England BioLabs). Phosphorylated primers were used to PCR amplify pQLinkN-pgaD to generate the plasmid pQLinkN-pgaD-FLAG ...
-
bioRxiv - Cell Biology 2021Quote: ... an NLS sequence was inserted downstream of the TagRFP sequence in the Cb expression vector described above with primers nls-insert_for and nls-insert_rev using the Q5 Site-Directed Mutagenesis Kit (NEB) and the resulting plasmid was used as a template to subsequently amplify the TagRFP-NLS sequence using the primers frag3-tRFP-nls_for and frag3-tRFP-nls_rev ...
-
bioRxiv - Plant Biology 2020Quote: ... were amplified from genomic DNA using primers in Supplemental Table 5 and Taq Phusion polymerase (New England BioLabs), cloned in pGEM-t Easy (Promega) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Systems Biology 2021Quote: ... The primers were designed to support HiFi DNA assembly (NEBuilder HiFi DNA Assembly Master Mix, New England BioLabs): dxs_thermus_F (5’-AAACCATGGAGGTGCGCGATATGATCTTGGACAAGGTGAAC-3’ ...
-
bioRxiv - Immunology 2021Quote: ... we modified the plasmid using primers EpMap_1 and EpMap_2 along with ssODN EpMap1_ssODN (Extended Data Table 3) using the NEBuilder Mastermix (NEB, E2621S) following the manufacturer’s instructions in order to create hairpin-free overlap regions that could be used for homology-based library cloning ...
-
bioRxiv - Microbiology 2020Quote: Amplification of adaptor-ligated DNA library was performed using barcoded primers and Phusion high-fidelity DNA polymerase (NEB) for 18 cycles according to provided instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... with additionally 1 μl oligo-dT primers and 1 μl of dNTP mix (NEB Biolabs, Ipswich, MA, USA). Further ...
-
bioRxiv - Cell Biology 2021Quote: ... with additionally 1 μl oligo-dT primers and 1 μl of dNTP mix (NEB Biolabs, Ipswich, MA, USA). Further ...
-
bioRxiv - Biophysics 2020Quote: ... ssM13mp18 at a concentration of 42 nM was mixed with 0.42 µM primer in NEBuffer 2.1(New England Biolabs). Samples were heated to 90°C for 30 seconds and cooled to 25°C at 0.1°C/sec ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used as template in a pre-amplification reaction by nested primers v2.1-F1 gagggcctatttcccatgattc and v2.1-R1 gttgcgaaaaagaacgttcacgg with 25 cycles and Q5 High-Fidelity DNA Polymerase (NEB), followed by unique barcoded primer combination for pool of all individual 50ul reactions for each genomic DNA sample ...
-
bioRxiv - Genetics 2022Quote: ... we PCR amplified NatMX from Addgene plasmid #35121 with the primers listed in Supplementary Table 6 using Phusion Hot Start Flex DNA polymerase (NEB). The NatMX cassette was transformed into the BY strain using the methods described above and transformants were plated onto YPD medium containing clonNAT ...
-
bioRxiv - Microbiology 2022Quote: ... The online NEBasechanger (https://nebasechanger.neb.com/) was used to design primers and the Q5 Site Directed Mutagenesis Kit (NEB) was used to generate pUPRTKO-ISC6pro-AC9ΔCC-3xTy (primers P13-14) ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Microbiology 2020Quote: ... 50 nM of each of the 27f and 534r primer mixes and 0.025U.μl−1 Taq DNA polymerase (NEB). The cycling parameters were 95 °C for 2 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... and barcoded using index primers from the NEBNext® Multiplex Oligos for Illumina® (New England BioLabs®) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... and barcoded using index primers from the NEBNext® Multiplex Oligos for Illumina® (New England BioLabs®). These libraries were processed using the MiSeq Reagent Kit v2 according to the manufacturer’s protocols and were sequenced in an Illumina MiSeq device in paired-end 2 × 150-bp mode.
-
bioRxiv - Molecular Biology 2019Quote: ... Non-overlapping forward and reverse primers containing the desired mutation were phosphorylated by polynucleotide kinase (New England Biolabs) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... A plasmid encoding T3D S1 in which a T249I mutation had been introduced into σ1 was engineered from the parental reverse genetics plasmid using ‘round the horn PCR (https://openwetware.org/wiki/%27Round-the-horn_site-directed_mutagenesis) with mutagenic primers (sequences available upon request) and Phusion High-Fidelity DNA Polymerase (New England Biolabs). Plasmids encoding rsT3DI segments with silent barcode mutations (Table 1 ...
-
bioRxiv - Genomics 2021Quote: ... The RNA samples were reverse transcribed using random hexamer primers and M-MuLV Reverse Transcriptase (New England Biolabs) and the resulting cDNA subjected to qPCR ...
-
bioRxiv - Biochemistry 2021Quote: ... 400 nM each of phosphorylated forward and reverse primers and 0.25 µL of Phusion Polymerase (2,000 U/mL) (NEB). PCR products were run on 1% agarose gels to confirm successful amplification ...
-
bioRxiv - Microbiology 2021Quote: ... SCBI genomic DNA with primers indicated in Supplementary Table S3 and using Q5 DNA Polymerase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... CREB (CCDS15005.1) and CRTC1 (CCDS40372.1) were amplified from mouse brain cDNA library by primers contain AgeI-HF (R3552L, NEB) and BamHI-HF (R3136L ...
-
bioRxiv - Cancer Biology 2021Quote: ... Poly(A)-cDNA was then amplified using an AL1 primer (ATTGGATCCAGGCCGCTCTGGACAAAATATGAATTCTTTTTTTTTTTTTTTTTTTTTTTT) and a blend of Taq polymerase (NEB) and Phusion (NEB).
-
bioRxiv - Immunology 2020Quote: ... before amplification with Illumina adapter-containing primers (Nextera i7 indices) and NEBNext Ultra II Q5 Master Mix (NEB) as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl of 100 μM SARS_139 and SARS_140 primers were mixed with 1 μl T4 Polynucleotide kinase (PNK; NEB) in 1x PNK reaction buffer (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... obtained with oligonucleotide primers listed in Table S4 and digested with the indicated restriction enzymes (New England Biolabs). Detection probes for phage DNA in Southern blots were generated by PCR using a non-proofreading polymerase (DreamTaq polymerase ...
-
bioRxiv - Cell Biology 2022Quote: ... we used three pairs of specific primers (Supplementary Table S2) with Q5 High Fidelity DNA Polymerase (NEB, M0491) or Phusion High Fidelity DNA Polymerase (Thermo Scientific Inc F530S) ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 ng of total RNA was mixed with 2 µL of random primer mix (New England Biolabs, UK) in RNase free PCR strips (Thermo Fisher ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were indexed with NEBNext Multiplex Oligos kit for Illumina (96 Index Primers, New England Biolabs, USA). Size distribution for the libraries and their quality were assessed using a high-sensitivity DNA chip (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Site-directed mutagenesis primers were designed using NEBasechanger and implemented through Q5 Site-Directed Mutagenesis (NEB, Cat #E0554S). For the cytoplasmic split-ubiquitin protein-protein interaction system ...
-
bioRxiv - Microbiology 2023Quote: ... 10µM of each primer and 10 μl of OneTaq 2X Master Mix with Standard Buffer (New England Biolabs) was used for double-strand DNA synthesis ...
-
bioRxiv - Microbiology 2023Quote: ... and the Tn7 transposon vector pEVS107 was linearized using primers RYI446 and RYI447 with Q5 DNA polymerase (NEB) (71) ...
-
bioRxiv - Microbiology 2023Quote: ... The gene of interest was amplified using primers described using either Q5 High-Fidelity DNA polymerase (NEB; M0491S) or Platinum Taq DNA polymerase High Fidelity (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... cDNAs and primers (listed in Table 4) were mixed with Luna Universal qPCR Master mix (New England Biolabs) and amplification was carried out in duplicate in a CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Bioengineering 2022Quote: ... ligated circular DNAs were amplified using GFP reporter-specific primers (IDT) and Q5 hot start DNA polymerase (NEB). Amplified DNA was sequenced (Azenta ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... using the primers outlined in Table S1 and Q5 Hot-start high fidelity polymerase (New England Biolabs M0494S). PCR products were extracted from standard agarose gels using the QIAquick Gel Extraction Kit (Qiagen 28704 ...
-
bioRxiv - Cancer Biology 2023Quote: Libraries were constructed with the NEBNext ChIP-Seq Library Prep with Unique Dual Index Primers (New England Biolabs) and sequenced on an Illumina NovaSeq instrument using the 2 × 50bp protocol to a depth of approximately 30M reads per sample ...
-
bioRxiv - Genetics 2024Quote: ... 0.5 µl of each primer (10 µM) and 12.5 µl Luna Universal Probe qPCR Master Mix (NEB, M3004) were mixed in a final volume of 25 µl ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The level 0 acceptor plasmid was amplified with the primer pair SLo0765/SLo0766 using Q5 DNA Polymerase (NEB) followed by a DpnI (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or Monarch PCR & DNA Cleanup Kit (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: PCR-amplified amplicons (Hotstart Q5 polymerase, NEB) were sanger sequenced using Genewiz sanger sequence service under standard manufacture instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... were subjected to a PCR test (NEB Taq Polymerase ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR was conducted with OneTaq® (NEB), per manufacture’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... PCR was run using Q5 polymerase (NEB) and a 50-62 °C annealing temperature gradient ...
-
bioRxiv - Developmental Biology 2020Quote: PCR products were digested with BsrI (NEB). Fragment sizes are 188 bp + 221 bp for wild type allele and 409 bp for vegfabmu155 allele.
-
bioRxiv - Developmental Biology 2020Quote: PCR products were digested with BccI (NEB). Fragment sizes are 116 bp + 123 bp for wild type allele and 239 bp for vegfaamu128 allele.
-
bioRxiv - Plant Biology 2019Quote: ... PCR reactions were performed with OneTaq (NEB), restriction enzymes were purchased from NEB as well as the T4 ligase and 100bp respectively 1kb ladder ...
-
bioRxiv - Genetics 2019Quote: ... PCR with OneTaq (NEB, Ipswich, MA, USA) was used to amplify wildtype Xenopus dyrk1a excluding the nucleotides coding for the stop codon ...
-
bioRxiv - Physiology 2021Quote: ... and Monarch PCR Cleanup Kit (NEB, T1030). PCR products were electrophoresed in 2% agarose gel (TopVision Agarose Tablets ThermoFisher R2801 ...