Labshake search
Citations for New England Biolabs :
2001 - 2050 of 10000+ citations for Cow Casein Kinase II Subunit Alpha 2 CSNK2A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Two reactions of 1-5μg DNA each were adaptor-ligated and indexed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) and NEBNext Multiplex Oligos for Illumina Primer sets 1 and 2 (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2021Quote: Sequencing libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB Cat. E7645S). For HA-Rap1 ChIP ...
-
bioRxiv - Molecular Biology 2019Quote: ... Library preparation was done according to the manufacturer’s instructions with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760) and analyzed with 2100 Bioanalyzer with DNA 1000 kit (Agilent) ...
-
bioRxiv - Genomics 2020Quote: ... and used to produce barcoded RNA sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep kit (New England Biolabs). Libraries were sequenced on Illumina NextSeq 500 ...
-
bioRxiv - Microbiology 2019Quote: ... Paired-end libraries were prepared according to the manufacturer’s recommendations using NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, USA). The libraries were indexed with NEBNext Multiplex Oligos kits for Illumina (96 Index Primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cDNA was purified with AmpureXP beads and library was prepared with NEBNext Ultra II DNA Library Prep Kit Illumina (NEB) according to the protocol and sequenced on a HiSeq2500 (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... ChIP-seq libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (E7645S, New England BioLabs) and Agencourt AMPure XP beads were used for size selection to generate the final libraries ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA-seq libraries were prepared from the mRNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Cluster generation was performed with the resulting libraries using the Illumina TruSeq PE Cluster Kit v4 reagents and sequenced on the Illumina HiSeq 2500 using TruSeq SBS Kit v4 reagents (Illumina) ...
-
bioRxiv - Genetics 2020Quote: ... ChIP enrichment was determined by RT-qPCR (Supplementary Table 5) prior to addition of sequencing adaptors using NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs). ATAC-seq was performed as previously described76 ...
-
bioRxiv - Genetics 2020Quote: ... all wells from a single plate were pooled and prepared for sequencing with the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs). Plates were multiplexed and sequenced on the MiSeq platform (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... or 100 ng of gDNA was assembled into paired-end libraries using the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs). Approximately 60 libraries were pooled per lane prior to sequencing on a HiSeq 4000 machine to a target depth of 0.5×.
-
bioRxiv - Microbiology 2019Quote: ... Insert and dual indexed libraries were prepared using a modified NEBNext Ultra DNA II dual indexing kit (New England Biolabs) without size selection ...
-
bioRxiv - Genomics 2019Quote: ... Immunoprecipitated and input material was phenol-chloroform purified and ChIP-seq libraries were prepared using the NEBNext Ultra II DNA library kit (NEB) according to the manufacturer’s instructions with 35ng of DNA of each sample ...
-
bioRxiv - Genomics 2019Quote: ... RNA-seq libraries were prepared using NEB’s NEBNext Ultra II Directional RNA Library Prep Kit for Illumina Sequencing (NEB EE7760S) and following the instructions for the poly(A ...
-
bioRxiv - Genetics 2020Quote: ... CUT&RUN dsDNA samples were quantified with a Qubit III and 5-10ng used as input for library preparation using the NEBNext Ultra II DNA Library Prep Kit for Illumina (#E7645S, NEB). Libraries were prepared using the following PCR program ...
-
bioRxiv - Genomics 2021Quote: Wild-type HAP1 samples were used for standard ChIP-seq library preparation with NEBNext Ultra II DNA Library Prep kit (New England Biolabs), followed by sequencing on NovaSeq 6000 ...
-
bioRxiv - Genomics 2021Quote: ... Shotgun sequencing was performed using a PCR-free DNA library preparation (NEBNext Ultra II DNA Library Prep Kit, New England Biolabs). Libraries were paired end 150 bp sequenced with Illumina HiSeqX ...
-
bioRxiv - Genetics 2019Quote: ... and used to construct DNA sequencing libraries using NEBNext Ultra II Directional RNA Library Prep kit (New England Biolabs E7760). DNA libraries were processed on a Illumina NextSeq machine for paired-end 42-nt sequencing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and prepared DNA-Seq libraries from 100 ng DNA using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs; 12 minutes enzymatic shearing ...
-
bioRxiv - Genomics 2021Quote: ... or the NEBNext Ultra II DNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (both New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... and TruSeq-barcoded RNAseq libraries were generated with the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). Sequencing was performed at the Cornell University Transcriptional Regulation and Expression Facility on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Three mRNA-seq libraries per condition were prepared using the NEBNext Ultra II directional RNA library Prep kit for Illumina (New England Biolabs), and read in paired-end 40-cycle sequencing runs on the NextSeq 500 system (Illumina) ...
-
bioRxiv - Microbiology 2020Quote: ... metagenomic libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit (New England Biolabs, Cat. No. E7645) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A library with 300-400 bp insert size for each pool was prepared using NEBNext Ultra II DNA Library Prep Kit (New England Biolabs). Libraries were then sequenced with 150 bp paired-end on the HiSeq X Ten platform.
-
bioRxiv - Biochemistry 2020Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs, Ipswich, MA, USA). Paired-end 100bp reads were performed on an Illumina HiSeq4000 ...
-
bioRxiv - Cell Biology 2021Quote: ... The procedure of the complementary DNA (cDNA) libraries was carried out with NEBNext Ultra II RNA library Prep kit (NEB) and NEBNextplex Oligos for Illumina following a previously described method (Kohno et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries were generated using a NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, Cat No. E7645), including fragmentation with a Covaris S220 sonic disruptor ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were then prepared from 500 ng genomic DNA using the NEBNext Ultra II FS DNA library prep kit for Illumina (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... About 10ng of the purified CUT&RUN DNA was used for preparation of multiplexed libraries with the NEB Ultra II DNA Library Prep Kit per manufacturer’s instruction (NEB #E7103). Sequencing was conducted using an Illumina NextSeq 500 Sequencing System (available from the core facility of UNC Pharmacology Department).
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were constructed with the NEBNext® Ultra™ II DNA Library Prep kit (New England Biolabs, MA, USA), and sequenced by Illumina-MiSeq at the Pittsburgh Bacteriophage Institute to an approximate shotgun coverage of 3538x ...
-
bioRxiv - Plant Biology 2020Quote: Sequencing libraries were generated from poly(A)-enriched RNA using the NEBNext Ultra II Directional RNA Library Prep kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Systems Biology 2020Quote: ... Library preparation was performed using the NEBNext®Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs), and library quantification was performed using the KAPA library quantification kit (Kapa Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... and the purified mRNA was used to build sequencing libraries using the Ultra II Directional RNA library Prep Kit for Illumina (NEB). Single end sequencing of 76 bp were performed on NextSeq instrument (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared for Illumina sequencing with NEBNext® Ultra™ II RNA Library Prep Kit for Illumina (NEB #E7775) accompanied by NEBNext Poly(A ...
-
Lessons from the meiotic recombination landscape of the ZMM deficient budding yeast Lachancea waltiibioRxiv - Genetics 2021Quote: ... DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were created using the NEBNext Ultra II DNA Library Prep kit for Illumina sequencing (New England Biolabs E7645L). All cDNA and library clean-up was done using SPRIselect beads (Beckman Coulter B23317).
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from high-titer phage lysates and sequencing libraries were prepared using the Ultra II FS Kit (New England Biolabs) or for ARB14 and ARB25 ...
-
bioRxiv - Plant Biology 2021Quote: ... the DNA of the two parents that generated the cross was extracted from flash-frozen young leaves using NEBNext Ultra II kit (NEB) and sequenced to ~40x coverage as 150 bp reads on an Illumina MiSeq at the Biological Nanostructures Lab in the California NanoSystem Institute at UC Santa Barbara ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA-Seq libraries were prepared from 1μg high quality RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs), according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... The mRNA libraries were generated using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs) and NEBNext Poly(A ...
-
bioRxiv - Cancer Biology 2021Quote: ... Purified ChIP DNA was used to prepare Illumina multiplexed sequencing libraries using the NEBNext Ultra II DNA Library Prep kit and the NEBNext Multiplex Oligos for Illumina (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fragments were end-repaired and ligated with Illumina compatible adaptors using the NEBNext UltraTM II DNA Library Prep Kit (NEB). The adaptor-ligated DNA was hybridized to custom Agilent biotinylated oligonucleotide probes across a 700bp region (53032 probes ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed for 60 min at 42 °C and 5 min at 80 °C using ProtoScript II First Strand cDNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Library construction was performed with 20ng of input total RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina - polyA mRNA workflow (New England Biolabs). The libraries were sequenced with a NextSeq 500 High Output 75 cycle kit (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: Sequencing libraries were prepared using the NEBNext Ultra II Directional Kit with polyA selection module (New England Biolabs, MA, USA). In brief ...
-
bioRxiv - Molecular Biology 2022Quote: 1 μg of total RNA was used to synthesize cDNA with dTALE gene specific primer dTALE-GSP_R0 (cgacttgagcagcaggagatgc) using the ProtoScript®II first strand cDNA synthesis kit (New England Biolabs) according to the manufacturer’s manual ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA enrichment and library preparation was performed using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II RNA Library Prep kit (NEB). Sequencing was done using the Illumina NextSeq500 to obtain >20 million 75bp single-end or 37bp paired-end reads per sample or at Genewiz (HiSeq ...
-
bioRxiv - Microbiology 2022Quote: ... 1μg of input RNA was used for RNA library preparation using the NEB Next Ultra II RNA Library Prep kit for Illumina (E7775L; NEB). Prepared libraries were quantified using real time PCR and bioanalyzer ...
-
bioRxiv - Genetics 2022Quote: ... We prepared the libraries with the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs, Ipswich, Massachusetts, USA) according to the manufacturer’s protocol ...