Labshake search
Citations for New England Biolabs :
1801 - 1850 of 10000+ citations for Cow Casein Kinase II Subunit Alpha 2 CSNK2A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... reverse transcribed using Protoscript II (NEB), and quantified using qPCR with primers for renilla luciferase (forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Protoscript II (New England Biolabs) reverse transcriptase ...
-
bioRxiv - Genomics 2019Quote: ... and 20 Units CviA II (NEB) at 25°C for 20 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... reverse transcribed using protoscript II (NEB) and RT primer oBZ408 (/5Phos/RNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSP18/TTC AGACGTGTGCTCTTCCGATCTGTCCTTGGTGCCCGAGTG) ...
-
bioRxiv - Bioengineering 2019Quote: ... isothermal buffer II (NEB, Ipswich, MA), betaine (Millipore Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 units/ml Dpn II (NEB) in RE buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... ProtoScript II reverse transcriptase from NEB was used to generate cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... then USER II enzyme (NEB, M5509) was added to cleave the product followed by a second column purification (Zymo research ...
-
bioRxiv - Biochemistry 2023Quote: ... pomatia RNA with Protoscript II (NEB) and random primers ...
-
bioRxiv - Biochemistry 2020Quote: ... the top strand (MB733) was 5′ labelled with ϒ[32P]- ATP and T4 polynucleotide kinase (T4 PNK; NEB) for 1 h at 37°C and cleaned up with a G-50 micro column as above ...
-
bioRxiv - Evolutionary Biology 2021Quote: 3’ dephosphorylation was performed by incubating fragments with 10 U/uL T4 Polynucleotide Kinase (New England Biolabs M0201S) in the supplied buffer (NEB B0201S ...
-
bioRxiv - Systems Biology 2019Quote: ... De-phosphorylated RNA was purified with an RNeasy MinElute spin column and re-phosphorylated with Polynucleotide Kinase (NEB). PNK-treated tRNAs were purified with an RNeasy MinElute spin column and ...
-
bioRxiv - Systems Biology 2019Quote: ... Each of the four-nucleic acid substrates were radiolabeled with [γ-32P]-ATP using T4 Polynucleotide Kinase (NEB). Free nucleotide was removed using G-25 MicroSpin columns (GE Healthcare) ...
-
bioRxiv - Biochemistry 2021Quote: ... primers containing overhangs of the 3x FLAG peptide were phosphorylated using the T4 polynucleotide kinase (New England BioLabs). Phosphorylated primers were used to PCR amplify pQLinkN-pgaD to generate the plasmid pQLinkN-pgaD-FLAG ...
-
bioRxiv - Neuroscience 2020Quote: ... The top and bottom oligos for the gRNA were phosphorylated and annealed using T4 polynucleotide kinase (PNK) (NEB) and then cloned into the pU6 vector (Addgene plasmid #53062) ...
-
bioRxiv - Plant Biology 2021Quote: ... and subsequently end repair (T4 DNA polymerase, Klenow DNA polymerase and T4 Polynucleotide Kinase; New England Biolabs, USA) and A-tailing (Klenow Fragment ...
-
bioRxiv - Molecular Biology 2019Quote: ... Non-overlapping forward and reverse primers containing the desired mutation were phosphorylated by polynucleotide kinase (New England Biolabs) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide pairs were resuspended to 100 μM and annealed in a polynucleotide kinase (PNK) mix (New England BioLabs) consisting of 1.5 μL of each oligonucleotide ...
-
bioRxiv - Genomics 2019Quote: Pairs of complementary DNA oligos (IDTDNA, Coralville, IA) were individually phosphorylated with T4 polynucleotide kinase (NEB, Ipswitch, MA) and then annealed ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The pooled duplex DNA (20 μL) was phosphorylated using T4 polynucleotide kinase (10 units; M0201S, New England Biolabs) in 10X T4 DNA ligase buffer (2 μL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... annealed by temperature decrease from 95 °C to 4 °C and phosphorylated using T4 Polynucleotide Kinase (NEB, M0201) according to manufactures’ protocol ...
-
bioRxiv - Genomics 2021Quote: ... in a 25 μL reaction containing 1X PNK buffer and 15 units of polynucleotide kinase (New England Biolabs) by incubating at 37°C for 45 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... gRNA oligos were annealed using T4 Polynucleotide Kinase (Fisher# 50811602) in T4 ligation buffer (New England Biolabs# B0202S) and then inserted into pU6-2-gRNA plasmids using T4 DNA ligase (New England Biolabs # M0202S).
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl of 100 μM SARS_139 and SARS_140 primers were mixed with 1 μl T4 Polynucleotide kinase (PNK; NEB) in 1x PNK reaction buffer (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... Each oligonucleotide pair was phosphorylated and annealed using the T4 Polynucleotide Kinase (New England Biolabs, Ipswich, MA, USA). Duplexed oligonucleotides were ligated into BbsI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA probes (Extended Table 1) at 500 nM were 5’-[32P]-labeled using T4 Polynucleotide Kinase (NEB) and hybridized to the membrane overnight at 37°C in PerfectHyb™ Plus Hybridization Buffer (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2023Quote: ... 13 pmol of purified RNA was phosphorylated with y-32P ATP (Hartmann Analytics) by T4 polynucleotide kinase (NEB) for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 20 pmol of the obtained RNA were then radiolabeled by incubation with 1 U of Polynucleotide Kinase (NEB) and 20 μCi of 32P-γATP for 1 h at 37°C in a 20 μL reaction volume ...
-
bioRxiv - Biochemistry 2023Quote: Pre-crRNA was 5’-radiolabeled with [γ−32P] ATP (Perkin-Elmer) using T4 polynucleotide kinase (New England Biolabs). For some measurements ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK, NEB). Next ...
-
bioRxiv - Cell Biology 2023Quote: ... 50pmol of each oligo were mixed in a 25µL reaction and phosphorylated with T4 polynucleotide kinase (M0201S, NEB). Reactions were performed for 30 min at 37°C in 1X T4 DNA ligase buffer (B0202S ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid was pre-treated with Alkaline phosphatase and amplicons were treated with T4 polynucleotide kinase (New England Biolabs). Cloned plasmids were subjected to colony PCR using Taq polymerase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligonucleotides corresponding to the ‘right’ half were 5′-phosphorylated using T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA). Equimolar amounts of ‘right’ strand ...
-
bioRxiv - Biochemistry 2023Quote: ... and a final concentration of 1.4 nM of hRNase 4 and 0.15 U/μL of polynucleotide kinase (New England Biolabs). The reactions were incubated at 37°C for 1 h and stopped by addition of murine RNase inhibitor to a final concentration of 2 U/μL and incubation at room temperature for 10 minutes ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... oligonucleotides encoding the crRNA sequences were custom synthesized (Integrated DNA Technologies) and incubated with T4 polynucleotide kinase (NEB) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... Specific probes were generated by end-labeling of oligodeoxyribonucleotides (Table S3) using T4 Polynucleotide Kinase (New England Biolabs) and [γ-32P]-ATP (Hartmann Analytic) ...
-
bioRxiv - Bioengineering 2023Quote: ... oligonucleotides encoding the crRNA targeting sequences were synthesized (Integrated DNA Technologies) and incubated with T4 polynucleotide kinase (NEB) for 30 min at 37° ...
-
bioRxiv - Neuroscience 2024Quote: ... The fragments were re-phosphorylated at their 5’-hydroxyl groups using T4 polynucleotide kinase (New England Biolabs; M0201S) and purified using the miRNeasy Mini Kit (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: ... Oligos containing the spacer sequence and Esp3I sticky ends were annealed and phosphorylated using T4 Polynucleotide Kinase (NEB) and purified using the Oligo Clean and Concentrator kit (Zymo Research) ...
-
bioRxiv - Immunology 2020Quote: ... and the assembled plasmid pCO1 was transformed into NEB® 5-alpha competent Escherichia coli (High Efficiency) (NEB) according to manufacturer’s instructions (see Supplementary Figure 1 for plasmid maps) ...
-
bioRxiv - Microbiology 2022Quote: ... Escherichia coli NEB® 5-alpha was used for plasmid assembly and cloning following the manufacturer’s instructions (NEB). Transformed E ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain MET961 was constructed by replacing the glgB gene of strain NEB 5-alpha (New England Biolabs) with the glgB::Kan-pWV01repA region from E ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA libraries were then constructed from 50 ng of depleted RNA using the NEBNext Ultra II Directional RNA library prep kit following manufacturer instructions (NEB). Libraries were size-selected to 200-700 bp using SPRIselect beads and quality was assessed on the Agilent Bioanalyzer using High Sensitivity DNA chips ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNA Magnetic Isolation Module and libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep kit (New England BioLabs). Library quality was checked on an Agilent TapeStation 4150 and quantified by Qubit 2000 fluorometer (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNA Magnetic Isolation Module and libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep kit (New England BioLabs). Library quality was checked on an Agilent TapeStation 4150 and quantified by Qubit 2000 fluorometer (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... were ligated to end-repaired and A-tailed chromatin using components from NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) (25).
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were constructed at the Center for Health Genomics and Informatics using the NEBNext Ultra II Directional RNA Library prep kit (New England Biolabs) with ribosomal RNA depletion ...
-
bioRxiv - Cell Biology 2019Quote: ... One μg of purified RNA was reverse transcribed into cDNA using the Protoscript II Reverse Transcriptase kit (New England Biolabs). Quantitative real time polymerase chain reactions (qRT-PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... the rRNA-depleted RNA was used to build the RNA-seq library with NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s manual ...