Labshake search
Citations for New England Biolabs :
1901 - 1950 of 10000+ citations for Cow Casein Kinase II Subunit Alpha 2 CSNK2A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... or the NEBNext Ultra II DNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (both New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... and TruSeq-barcoded RNAseq libraries were generated with the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). Sequencing was performed at the Cornell University Transcriptional Regulation and Expression Facility on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Three mRNA-seq libraries per condition were prepared using the NEBNext Ultra II directional RNA library Prep kit for Illumina (New England Biolabs), and read in paired-end 40-cycle sequencing runs on the NextSeq 500 system (Illumina) ...
-
bioRxiv - Microbiology 2020Quote: ... metagenomic libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit (New England Biolabs, Cat. No. E7645) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A library with 300-400 bp insert size for each pool was prepared using NEBNext Ultra II DNA Library Prep Kit (New England Biolabs). Libraries were then sequenced with 150 bp paired-end on the HiSeq X Ten platform.
-
bioRxiv - Biochemistry 2020Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs, Ipswich, MA, USA). Paired-end 100bp reads were performed on an Illumina HiSeq4000 ...
-
bioRxiv - Cell Biology 2021Quote: ... The procedure of the complementary DNA (cDNA) libraries was carried out with NEBNext Ultra II RNA library Prep kit (NEB) and NEBNextplex Oligos for Illumina following a previously described method (Kohno et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries were generated using a NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, Cat No. E7645), including fragmentation with a Covaris S220 sonic disruptor ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were then prepared from 500 ng genomic DNA using the NEBNext Ultra II FS DNA library prep kit for Illumina (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... About 10ng of the purified CUT&RUN DNA was used for preparation of multiplexed libraries with the NEB Ultra II DNA Library Prep Kit per manufacturer’s instruction (NEB #E7103). Sequencing was conducted using an Illumina NextSeq 500 Sequencing System (available from the core facility of UNC Pharmacology Department).
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were constructed with the NEBNext® Ultra™ II DNA Library Prep kit (New England Biolabs, MA, USA), and sequenced by Illumina-MiSeq at the Pittsburgh Bacteriophage Institute to an approximate shotgun coverage of 3538x ...
-
bioRxiv - Plant Biology 2020Quote: Sequencing libraries were generated from poly(A)-enriched RNA using the NEBNext Ultra II Directional RNA Library Prep kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Systems Biology 2020Quote: ... Library preparation was performed using the NEBNext®Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs), and library quantification was performed using the KAPA library quantification kit (Kapa Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... and the purified mRNA was used to build sequencing libraries using the Ultra II Directional RNA library Prep Kit for Illumina (NEB). Single end sequencing of 76 bp were performed on NextSeq instrument (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared for Illumina sequencing with NEBNext® Ultra™ II RNA Library Prep Kit for Illumina (NEB #E7775) accompanied by NEBNext Poly(A ...
-
Lessons from the meiotic recombination landscape of the ZMM deficient budding yeast Lachancea waltiibioRxiv - Genetics 2021Quote: ... DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were created using the NEBNext Ultra II DNA Library Prep kit for Illumina sequencing (New England Biolabs E7645L). All cDNA and library clean-up was done using SPRIselect beads (Beckman Coulter B23317).
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from high-titer phage lysates and sequencing libraries were prepared using the Ultra II FS Kit (New England Biolabs) or for ARB14 and ARB25 ...
-
bioRxiv - Plant Biology 2021Quote: ... the DNA of the two parents that generated the cross was extracted from flash-frozen young leaves using NEBNext Ultra II kit (NEB) and sequenced to ~40x coverage as 150 bp reads on an Illumina MiSeq at the Biological Nanostructures Lab in the California NanoSystem Institute at UC Santa Barbara ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA-Seq libraries were prepared from 1μg high quality RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs), according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... The mRNA libraries were generated using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs) and NEBNext Poly(A ...
-
bioRxiv - Cancer Biology 2021Quote: ... Purified ChIP DNA was used to prepare Illumina multiplexed sequencing libraries using the NEBNext Ultra II DNA Library Prep kit and the NEBNext Multiplex Oligos for Illumina (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fragments were end-repaired and ligated with Illumina compatible adaptors using the NEBNext UltraTM II DNA Library Prep Kit (NEB). The adaptor-ligated DNA was hybridized to custom Agilent biotinylated oligonucleotide probes across a 700bp region (53032 probes ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed for 60 min at 42 °C and 5 min at 80 °C using ProtoScript II First Strand cDNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Library construction was performed with 20ng of input total RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina - polyA mRNA workflow (New England Biolabs). The libraries were sequenced with a NextSeq 500 High Output 75 cycle kit (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: Sequencing libraries were prepared using the NEBNext Ultra II Directional Kit with polyA selection module (New England Biolabs, MA, USA). In brief ...
-
bioRxiv - Molecular Biology 2022Quote: 1 μg of total RNA was used to synthesize cDNA with dTALE gene specific primer dTALE-GSP_R0 (cgacttgagcagcaggagatgc) using the ProtoScript®II first strand cDNA synthesis kit (New England Biolabs) according to the manufacturer’s manual ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA enrichment and library preparation was performed using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II RNA Library Prep kit (NEB). Sequencing was done using the Illumina NextSeq500 to obtain >20 million 75bp single-end or 37bp paired-end reads per sample or at Genewiz (HiSeq ...
-
bioRxiv - Microbiology 2022Quote: ... 1μg of input RNA was used for RNA library preparation using the NEB Next Ultra II RNA Library Prep kit for Illumina (E7775L; NEB). Prepared libraries were quantified using real time PCR and bioanalyzer ...
-
bioRxiv - Genetics 2022Quote: ... We prepared the libraries with the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs, Ipswich, Massachusetts, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... All samples were processed in a single batch and the isolated mRNA from each sample was used to prepare RNA sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: Illumina libraries were constructed from 100 ng of amplified cDNA libraries using the NEBNext Ultra II FS library prep kit for Illumina (New England Biolabs) with some modifications ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Extracted gDNA was prepared for sequencing using a modified protocol63 for the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) at ½ of the recommended reaction volume ...
-
bioRxiv - Physiology 2022Quote: ... Stranded cDNA libraries were created with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The 30 fish were sequenced for 100 base pair reads on one lane of a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse transcription of 50 ng total RNA was performed using Protoscript II First Strand cDNA Synthesis Kit with oligo(dT)23 primers (NEB). cDNA was undiluted ...
-
bioRxiv - Developmental Biology 2022Quote: ... IGM generated sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760, New England Biolabs). A polyA enrichment step (E7490 ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were prepared for metatranscriptomic sequencing using the NEB-Next Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) with the addition of an rRNA depletion step (NEBNext rRNA Depletion Kit (Human/Mouse/Rat) ...
-
bioRxiv - Genomics 2022Quote: ... The remaining steps of library preparation were done using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). Adapters and PCR primers from New England BioLabs were employed ...
-
bioRxiv - Microbiology 2022Quote: ... 5 ng of total RNA was used for intact RNA library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760, New England BioLabs). To obtain sufficient RNA for the analysis of oral samples ...
-
bioRxiv - Microbiology 2022Quote: RNA library was assembled using NEBNext Poly(A) mRNA Magnetic Isolation Module (E7490) and NEBNext Ultra II RNA Library Prep Kit for Illumina (E7770, New England Biolabs) as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were prepared from the cDNA using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs). Libraries were sequenced with the Illumina HiSeq 2500 or 4000 systems to produce 100bp paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... The extracted RNA was then reverse transcribed to cDNA using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... Subsequently the libraries were prepared with the NEBNext® Ultra II DNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The final double strand DNA fragments pool was ligated with adapters and amplified with Illumina index primers by using NEBNext Ultra II NGS library prep kit (NEB). The prepared NGS library was sequenced as 150×150 bp pair-end sequencing in the Miseq or Hiseq 2500.
-
bioRxiv - Biochemistry 2022Quote: ... sequencing libraries were prepared with a NEBNext Ultra II Directional RNA Library Prep Kit (7765L, New England Biolabs, Ipswich, MA), and samples were sequenced on an Illumina NextSeq 500 platform in 76bp single-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... Poly-A(+) RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). Two µg of RNA per sample were processed in two separate reactions (separate technical replicas ...
-
bioRxiv - Microbiology 2022Quote: ... RNA-seq libraries were prepared from mRNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) as by manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Isolated mRNA was used to generate dual-indexed cDNA libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Eight cycles of PCR amplification were applied to all the libraries ...
-
bioRxiv - Immunology 2022Quote: Fragmentasion and adaptor ligation were performed using 10-20ng of second-PCR product as a template with NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs) with some modifications ...