Labshake search
Citations for New England Biolabs :
1951 - 2000 of 10000+ citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2019Quote: ... and 1 µL was used as the template in a PCR amplification containing 0.5 µL of Q5 High-Fidelity DNA Polymerase (NEB, M0491S), 1x Q5 polymerase reaction buffer (NEB ...
-
bioRxiv - Genomics 2020Quote: Cas9 protein and transcribed sgRNA were incubated for 10 min at room temperature in reaction buffer containing 1× NEB buffer 3.1 (NEB Biolabs) supplemented with 1 mM DTT ...
-
bioRxiv - Genomics 2019Quote: ... we eluted the RNA by adding 4 µl of master mix containing 1 µl of 10 mM dNTPs (New England Biolabs), 0.1 µl of 100 µM 3’ SMART reverse transcriptase (RT ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification was performed in a total volume of 25 µl containing 12.5 µl of 2x OneTaq Mastermix (New England Biolabs, NEB), 9.9 µl of nuclease-free H2O ...
-
bioRxiv - Physiology 2020Quote: ... and the Esp3I fragment of the pPVxRF3 vector (a gift from S. Kondo) containing Venus and 3xP3-dsRed-Express2 using NEBuilder HiFi DNA Assembly Master Mix (NEB). The combined fragment was cloned into pBluescript ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCR reaction volumes were set up to 12.5 μL containing Luna Universal qPCR Master Mix (New England Biolabs Inc.), 2 μl of a 1:10 dilution of cDNA reaction ...
-
bioRxiv - Genetics 2020Quote: ... Oligo pairs were mixed at an equimolar ratio in PCR tubes containing T4 Ligation buffer and T4 polynucleotide kinase (NEB) for 5’ phosphorylation of oligos ...
-
bioRxiv - Genomics 2021Quote: ... Methylation reactions were performed in a 100uL reaction containing 1X CutSmart Buffer and 1mM S-adenosyl-methionine (SAM, New England Biolabs) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... the genomic regions containing pre-miR775a and the GALT9 coding region were PCR amplified using the Pfusion DNA polymerase (New England Biolabs) and primers listed in Supplemental Table 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... and 3 kb of upstream sequence containing the promoter was amplified from Arabidopsis genomic DNA using Phusion polymerase (New England Biolabs) using flanking primers and then the primers RSH1-F (TCCGTCTTGTCTGAATCAGCT ...
-
bioRxiv - Neuroscience 2020Quote: ... and Genomic DNA was isolated and subjected to PCR to amplify the 433 bp fragment containing gRNA target sequence using Q5 High Fidelity DNA polymerase (NEB) and primers (GAATTC(EcoRI)/GAGTTCTAGTGTCAGAAGAAAAAAGATGAATTTTATTCC and GGATCC(BamHI)/AGCTTTAATAGTGTGCAGGGTCAGTCAG) ...
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... After bead purification half of the DNA elute was used for a 50-µl PCR reaction containing the NEBNext High-Fidelity 2x Master Mix (NEB), 25 pmol ...
-
bioRxiv - Neuroscience 2020Quote: ... FRT::STOP::FRT sequences were amplified from sequences in the ser-2(2)p::FRT::YFP plasmid (gift from Shawn Xu), and inserted into a vector containing GCaMP6s sequences (Wu et al., 2019) by Gibson assembly (New England BioLabs). ser-2(2)p (4.7 kb ...
-
bioRxiv - Immunology 2021Quote: ... Restriction digest of pMK-RQ plasmid DNA containing EtIMP1 was performed using Bam HI and Not I restriction enzymes (New England Biolabs). Restriction digest of pYD1-EtAMA1Cit plasmid was performed with the same restriction enzymes to remove the EtAMA1 insert but retain the citrine tag ...
-
bioRxiv - Microbiology 2021Quote: ... The 11.4 kb and 304 bp degenerate barcode containing fragments were joined by Gibson assembly using HiFi DNA assembly mix (New England Biolabs) in a molar ratio of 1:5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then ligated to pre-annealed double-stranded adaptors that contain single dT overhangs and a unique molecular identifier (UMI) consisting of a randomized 8-base sequence containing a 3-base specific barcode by T4 DNA ligase (NEB) overnight at 15 °C ...
-
bioRxiv - Microbiology 2019Quote: ... the RH-Luc+/Δgra45 parasites were co-transfected with plasmids containing sgRNAs specifically targeting the UPRT locus and SalI (New England Biolabs)-linearized pUPRT::GRA45HA plasmid at a ratio 1:5 of sgRNAs to linearized plasmid ...
-
bioRxiv - Genomics 2021Quote: ... a lentiCRISPRv2 derivative containing an optimized scaffold (5’-GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTT-3’)40 were digested sequentially with NheI and BamHI (New England Biolabs). The vector and fragment were purified using the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: Myc-6xHis Sec24D was then subcloned from pcDNA3.1 myc-6xHis Sec24D into pENTR containing a multiple cloning site (gift from Dr. Vann Bennett) using Gibson Assembly (E5510, New England Biolabs). pENTR was linearized with EcoRI (R3101 ...
-
bioRxiv - Cell Biology 2020Quote: ... Myc-6xHis Sec24C was then subcloned into pENTR containing a multiple cloning site (gift from Dr. Vann Bennett) using Gibson Assembly (E5510, New England Biolabs). pENTR was linearized with NotI (R3189 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ends were subsequently ligated by adding a 900 μL master mix containing 120 μL 10X T4 DNA ligase buffer (NEB), 100 μL 10% TritionX-100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a kind gift from Jelena Jakovlievic) and cloned into a T7 promoter-containing plasmid digested with EcoRI and HindIII using Gibson Assembly (NEB). The resulting plasmids were then digested with HindIII and run-off transcription was performed using the MEGAscript T7 kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA-bound beads were re-suspended in 100 µl of mix containing 82 µl of 1X NEB T4 DNA ligase buffer with 10mM ATP (NEB), 10 µl of 10 (2.5mM each ...
-
bioRxiv - Genetics 2022Quote: ... We produced linear DNA transformation fragments by digesting TFT-containing plasmids with SacI and BglII and gel purifying the fragments (Monarch Gel Purification, NEB). Genomic integration of each linear transformation fragment results in deletion of the LYP1 gene ...
-
bioRxiv - Neuroscience 2022Quote: ... was cloned into pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). The exact same purification scheme for DDX5(1-535)-SNAP was used to purify DDX5(1-483)-SNAP and the protein was flash frozen in medium salt storage buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: The full-length African killifish DDX5 was cloned into the pDEST17 vector containing an N-terminal His10-tag and a C-terminal SNAP-tag (New England BioLabs). E ...
-
bioRxiv - Neuroscience 2022Quote: The full-length African killifish DDX5 was cloned into the pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). E ...
-
bioRxiv - Neuroscience 2022Quote: ... was cloned into the pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). The same purification scheme was used to purify DDX5(1-535)-SNAP than DDX5-SNAP ...
-
bioRxiv - Microbiology 2022Quote: ... was performed using specific primers containing a 5’ T7 promotor sequence adapted to both forward and reverse primers and Taq polymerase (NEB). PCR products were purified using the GeneJET PCR Purification kit (Thermo Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... upstream of the predicted operon containing the kaiC gene were amplified by PCR using the Phusion DNA polymerase (New England Biolabs) and cloned between the EcoRI and HindIII sites of the pPROBE-TT’ [21] ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ and 3’ flanking sequences containing recognition sites for the Type II restriction enzyme BsaI-HF®v2 (NEB, R3733) were added to each IUPAC DNA block ...
-
bioRxiv - Bioengineering 2022Quote: ... Annealed oligonucleotides were then ligated into the BbsI restriction sites of pSP-gRNA or our previously described split-intein CBE-containing plasmids 55 using T4 DNA ligase (NEB).
-
bioRxiv - Cell Biology 2022Quote: Cellularized blastoderms were individually squashed and then lysed in 10 µL buffer containing Proteinase K and ThermoPol reaction buffer (New England BioLabs) for 45 min at 60°C then 10 min at 95°C ...
-
bioRxiv - Microbiology 2021Quote: ... by removing media and washing cells with cold PBS and subsequently scraped into 50 – 200 μl (depending on dish size) lysis buffer containing protease inhibitor (#5872, NEB). The sample was then left on ice for at least 20 mins and subsequently spun down at 20,000 x g for 10 mins at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... Eluted cDNA was transferred to a new PCR tube containing 15 μL of 2X Phusion HF-PCR Master Mix (NEB), 0.5 μL of 30 μM P3/P6 PCR1 oligo mix and 0.5 μl of 15x SYBR Green I (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H218O (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... libraries of sensors in the pRSET-A bacterial expression vector were generated using primers containing degenerate codons (NNS) with Q5 site-directed mutagenesis (New England BioLabs) and transformed into T7 Express competent cells (New England BioLabs) ...
-
bioRxiv - Immunology 2021Quote: ... a flow-focusing device was used to encapsulate individual T cells into emulsification droplets containing lysis buffer and oligo(dT) magnetic beads (New England Biolabs)30 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Targeting constructs containing the sequence to be inserted and approximately 500 bp homology arms were cloned by Gibson Assembly (NEB). The FKBP12F36V tag (dTAG ...
-
bioRxiv - Systems Biology 2022Quote: ... a partial Illumina Read1 sequencing adapter containing a plate-specific barcode was single-strand ligated using T4 RNA ligase I (NEB) and the product was reverse-transcribed ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were incubated for 45 min at 37°C and then transferred to a tube containing the ligation reaction (160 µL NEB ligation buffer 10X ...
-
bioRxiv - Genomics 2022Quote: ... 100 microliters of beads were distributed into each well of a 96-well plate containing a unique barcode with 1x T4 ligation buffer and 1.9 U/ul T4 DNA ligase (NEB #M0202M). Ligations were incubated at 25C for 1 hour and heat inactivated at 65C for 10 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... The empty vector pKH37 and the plasmids containing the desired ponA sequences were methylated with HaeIII methyltransferase (New England Biolabs), linearized with the restriction enzyme PciI (New England Biolabs) ...
-
bioRxiv - Genomics 2019Quote: The degenerate barcoded plasmid was used as template for PCR using primers containing gene-specific targeting homology arms (1× NEB Q5 Master Mix #M0494S ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 25–50 ng of template DNA was added to Polymerase Chain Reactions (PCR) containing 1× Standard Taq Buffer (New England Biolabs), 2.5 mm MgCl (New England Biolabs) ...
-
bioRxiv - Biochemistry 2019Quote: ... were produced by PCR amplification of the starting plasmid with forward and reverse mutagenesis primers containing the desired mutations (Table S9) followed by DpnI (NEB) treatment ...
-
bioRxiv - Biophysics 2019Quote: ... and 15-25 μM of BG-oligonuculeotides were labeled with ∼ 1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Synthetic Biology 2019Quote: ... two oligonucleotides were designed with an overlap of 35 bp containing the T7 promoter sequence and amplified using Q5 High-Fidelity DNA polymerase (NEB) according to the suppliers instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... We tested all primers using 1uL of genomic DNA from H9 human ES cells in a PCR reaction containing 12.5 uL Phusion High Fidelity PCR Master Mix (NEB, M0531L), 1.25 uL 5 uM forward primer ...