Labshake search
Citations for New England Biolabs :
1951 - 2000 of 3219 citations for 6 fluorohexane 1 sulfonyl fluoride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... A total of 1 μg of cDNA was prepared using the M-MulV reverse transcriptase (NEB) as per vendor instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... diluted 1:10 in PBS-BSA (PBS supplemented with 0.4 mg/mL BSA (New England Biolabs)) ...
-
bioRxiv - Biophysics 2023Quote: ... before staining with SNAP dye buffer (1 µM BG-AF647 (catalog no. S9136S, New England Biolabs) and 1 µM dithiothreitol in 0.5% [w/v] BSA in PBS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Template plasmid was then removed by addition of 1 μL DpnI (New England BioLabs, Cat.#R0176), 5 μL 10X FastDigest Buffer (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... The sections were then incubated in a ligation mix (1× T4 Rnl2 reaction buffer (NEB, B0239SVIAL), 0.05 µM RCA primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Genomic DNA (1 µg) was digested with the methylation-sensitive restriction enzyme HpaII (New England Biolabs) and analyzed by Southern hybridization with a specific biotin-labeled DNA probe (300 ng ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of total RNA was reverse transcribed using LunaScript RT SuperMix Kit (New England Biolabs) according to the manufacturer’s instructions and 1 µl cDNA was used as a template for a 10 µl qPCR reaction ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg of RNA was used for cDNA synthesis using the LunaScript RT SuperMix Kit (NEB) with and without reverse-transcriptase ...
-
bioRxiv - Microbiology 2024Quote: ... two inverse PCRs were carried out using R3-p21 as a template and oligonucleotides Trip.A.For/Trip.A.Rev and Trip.B.For/Trip.B.Rev (Supplementary Table 1) using Phusion High-Fidelity DNA Polymerase (New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: 10µg of a plasmid containing 807bp of Pcdh10 exon 1 sequence was linearized with SacII (NEB) in 1x CutSmart buffer (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... MssI and XhoI restriction enzymes and a Quick-Load® 1 kb Extend DNA Ladder (NEB). Plasmid curing was confirmed by loss of pESI related antibiotic resistance ...
-
bioRxiv - Genomics 2023Quote: 1-2 µg of extracted total RNA and polysomal RNA was treated with DNaseI (NEB, M0303) in a 100 µL reaction at 37 °C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was produced from ∼1 µg of RNA using M-MuLV Reverse Transcriptase (New England Biolabs). RTqPCR was performed on 1:10 dilutions of the cDNA using iTaq Universal SYBR Green Supermix (Bio Rad ...
-
bioRxiv - Cancer Biology 2024Quote: RNAs were transcribed from 1 µg of PCR-amplified templates using T7 RNA polymerase (NEB M0251S) for 2 h at 37 °C according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Microbiology 2024Quote: ... 5 units (2.5 μL) of RNase free DNAse I (NEW ENGLAND BioLabs, 2000 u. mL-1) and 100 μL of nuclease free water was added for every 10 μg of RNA ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were mixed with 1/5th volume of 6X gel loading buffer (New England Biolabs®) and then electrophoresed in pairs alongside their undigested counterparts on an agarose gel as described below ...
-
bioRxiv - Microbiology 2020Quote: ... Template DNA was then digested by addition of 20 units (1 μl) DpnI restriction enzyme (NEB: R0176S) and incubation at 37°C for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... RNase III cleavage reactions contained 1 mM DTT and 1.3 U of enzyme (New England Biolabs #M0245S), and were incubated for 6 min at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... 1 μL of this PCR reaction was then combined with 5 μL Q5 buffer (NEB, cat#M0491S), 0.5 μL 10mM DNTP (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... NEBNext® Multiplex Oligos for Illumina® Dual Index Primers Set 1 (cat. #E7600, New England Biolabs), and AMPure® XP Beads (cat ...
-
bioRxiv - Microbiology 2021Quote: ... RT was performed using 1 μg of RNA using LunaScript™ RT SuperMix Kit (New England BioLabs) per manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sequences were indexed using the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1, NEB #E7600). A series of sequencing runs were performed on Illumina and PacBio platforms ...
-
bioRxiv - Microbiology 2021Quote: ... 60 μL of each fraction was treated with 1 μL of thermolabile proteinase K (New England Biolabs) for 1 h at 37°C followed by inactivation for 10 min at 55°C.
-
bioRxiv - Genomics 2020Quote: ... 1 μg of the blunt-ended DNA was further incubated in 1x T4 DNA ligase buffer (NEB) in 1x T4 DNA ligase buffer (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... crassa strains expressing a Dam fusion was digested with 1 μL of DpnI (NEB, 20 units/μL); ligation to primer 5050 was carried out overnight at 16 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended using 100μL resuspension buffer (10mM Tris pH 7.0, 1% SDS and 0.01U/μL proteinase K (NEB)) for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1μl of a 1:250 dilution of annealed gRNAs was ligated with the T4 DNA Ligase (NEB) into 36ng of the px459 V2.0 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... The beads to which GFP-DSB-1 had been immobilized were subject to the phosphatase assay (NEB lambda phosphatase #P0753S ...
-
bioRxiv - Cell Biology 2022Quote: ... pET17b-Kif5b(1-560)-GFP-His was transformed into BL-21[DE3]RIPL cells (New England Biolabs) until an optical density at 600 nm of 0.6-0.8 and expression was induced with 0.5 mM isopropyl-β-d-thiogalactoside (IPTG ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Genomics 2020Quote: ... 8.5 uL of this phosphorylated product was combined with 1 uL of 10X T4 ligase buffer (NEB) and 0.5 uL of T4 DNA ligase (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... Template DNA was then digested by addition of 20 units (1 μl) DpnI restriction enzyme (NEB: R0176S) and incubation at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 µg RNA was used for each reverse transcriptase reaction using M-MuLV Reverse Transcriptase (NEB) according to manufacturer protocol ...
-
bioRxiv - Molecular Biology 2019Quote: Five pmol of each standard was dephosphorylated in a 100 μL reaction of 1× CutSmart Buffer (NEB) with 5 units of calf intestinal alkaline phosphatase (CIP ...
-
bioRxiv - Physiology 2020Quote: ... 1 nl of CRISPR mixture containing 2,4 μg/μl of gRNA and 0.5 μl Cas9 protein (NEB) was injected in one-cell stage embryos and raised for 24 hours ...
-
bioRxiv - Synthetic Biology 2019Quote: ... at a ratio of 1:40 using 0.5 µL of Q5 High-Fidelity DNA Polymerase (NEB, M0491S) in a 50 µL reaction containing 1x Q5 polymerase reaction buffer (NEB ...
-
bioRxiv - Plant Biology 2019Quote: 1 μg sheared DNA fragments were end-repaired with Ultra II End-prep enzyme mix (E7546L, NEB) for 5 minutes at 20°C and 5 minutes at 65°C using a thermal cycler ...
-
bioRxiv - Cell Biology 2019Quote: ... then incubated with either mouse anti-MBP antibodies at a dilution of 1:5000 (New England Biolabs) or 1:2500 mouse anti-GFP antibodies (Roche ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sequences were indexed using the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1, NEB #E7600). We sequenced paired end libraries at the Institute for Biotechnology at Cornell University ...
-
bioRxiv - Biochemistry 2020Quote: ... treated with lambda phosphatase protein after purification at 30°C for 1 hr (New England BioLabs, P0753L), or co-expressed in BL21 cells with RFP-lambda phosphatase ...
-
bioRxiv - Bioengineering 2020Quote: Total RNA was extracted from 1 million cells using the Monarch Total RNA Miniprep Kit (NEB, #T2010S). We prepared cDNA from 1 μg of extracted RNA using LunaScript® RT SuperMix Kit (NEB ...
-
bioRxiv - Bioengineering 2020Quote: ... We prepared cDNA from 1 μg of extracted RNA using LunaScript® RT SuperMix Kit (NEB, #E3010). No Template and No Reverse Transcriptase controls (NTC and NRT ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA was prepared from 1 million cells using the Monarch Genomic DNA Purification Kit (NEB, #T3010G). Diagnostic PCR was then carried out followed by gel extraction (NucleoSpin ...
-
bioRxiv - Biophysics 2021Quote: ... and 3 samples from each replicate combined into 7 mL with 1 × T4 DNA Ligase Buffer (NEB), with 1% Triton X-100 ...
-
bioRxiv - Neuroscience 2020Quote: ... Plasmid DNA was digested for 1 hour at 37°C with NcoI (New England BioLabs, Ipswich, MA) unless otherwise specified in a final volume of 20 μl before evaluating restriction fragment patterns by 1% agarose gel electrophoresis ...
-
bioRxiv - Biophysics 2021Quote: Time-resolved experiments with TEV protease were performed by adding 1 μL TEV protease (New England Biolabs) after the 3rd time point to an imaging well containing 100 μL protein sample ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of N protein was dissolved in 36 μL H218O and 2 μL 10x glycobuffer (NEB). To this solution 2 μL PNGase F was added and the reaction mixture was incubated at 37 °C for 16 h ...
-
bioRxiv - Biochemistry 2020Quote: ... and 20 µL of 20 U/µL MNase (New England BioLabs, 1/1000 dilution of commercial stock). Reactions were digested for 1 minute and quenched with 2 µL 500 mM EDTA and thorough pipetting ...