Labshake search
Citations for New England Biolabs :
2101 - 2150 of 3418 citations for 6 fluorohexane 1 sulfonyl fluoride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... NEBNext® Multiplex Oligos for Illumina® Dual Index Primers Set 1 (cat. #E7600, New England Biolabs), and AMPure® XP Beads (cat ...
-
bioRxiv - Microbiology 2021Quote: ... RT was performed using 1 μg of RNA using LunaScript™ RT SuperMix Kit (New England BioLabs) per manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sequences were indexed using the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1, NEB #E7600). A series of sequencing runs were performed on Illumina and PacBio platforms ...
-
bioRxiv - Microbiology 2021Quote: ... 60 μL of each fraction was treated with 1 μL of thermolabile proteinase K (New England Biolabs) for 1 h at 37°C followed by inactivation for 10 min at 55°C.
-
bioRxiv - Genomics 2020Quote: ... 1 μg of the blunt-ended DNA was further incubated in 1x T4 DNA ligase buffer (NEB) in 1x T4 DNA ligase buffer (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... crassa strains expressing a Dam fusion was digested with 1 μL of DpnI (NEB, 20 units/μL); ligation to primer 5050 was carried out overnight at 16 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended using 100μL resuspension buffer (10mM Tris pH 7.0, 1% SDS and 0.01U/μL proteinase K (NEB)) for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1μl of a 1:250 dilution of annealed gRNAs was ligated with the T4 DNA Ligase (NEB) into 36ng of the px459 V2.0 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... The beads to which GFP-DSB-1 had been immobilized were subject to the phosphatase assay (NEB lambda phosphatase #P0753S ...
-
bioRxiv - Cell Biology 2022Quote: ... pET17b-Kif5b(1-560)-GFP-His was transformed into BL-21[DE3]RIPL cells (New England Biolabs) until an optical density at 600 nm of 0.6-0.8 and expression was induced with 0.5 mM isopropyl-β-d-thiogalactoside (IPTG ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Genomics 2020Quote: ... 8.5 uL of this phosphorylated product was combined with 1 uL of 10X T4 ligase buffer (NEB) and 0.5 uL of T4 DNA ligase (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... Template DNA was then digested by addition of 20 units (1 μl) DpnI restriction enzyme (NEB: R0176S) and incubation at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 µg RNA was used for each reverse transcriptase reaction using M-MuLV Reverse Transcriptase (NEB) according to manufacturer protocol ...
-
bioRxiv - Molecular Biology 2019Quote: Five pmol of each standard was dephosphorylated in a 100 μL reaction of 1× CutSmart Buffer (NEB) with 5 units of calf intestinal alkaline phosphatase (CIP ...
-
bioRxiv - Physiology 2020Quote: ... 1 nl of CRISPR mixture containing 2,4 μg/μl of gRNA and 0.5 μl Cas9 protein (NEB) was injected in one-cell stage embryos and raised for 24 hours ...
-
bioRxiv - Synthetic Biology 2019Quote: ... at a ratio of 1:40 using 0.5 µL of Q5 High-Fidelity DNA Polymerase (NEB, M0491S) in a 50 µL reaction containing 1x Q5 polymerase reaction buffer (NEB ...
-
bioRxiv - Plant Biology 2019Quote: 1 μg sheared DNA fragments were end-repaired with Ultra II End-prep enzyme mix (E7546L, NEB) for 5 minutes at 20°C and 5 minutes at 65°C using a thermal cycler ...
-
bioRxiv - Cell Biology 2019Quote: ... then incubated with either mouse anti-MBP antibodies at a dilution of 1:5000 (New England Biolabs) or 1:2500 mouse anti-GFP antibodies (Roche ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sequences were indexed using the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1, NEB #E7600). We sequenced paired end libraries at the Institute for Biotechnology at Cornell University ...
-
bioRxiv - Biochemistry 2020Quote: ... treated with lambda phosphatase protein after purification at 30°C for 1 hr (New England BioLabs, P0753L), or co-expressed in BL21 cells with RFP-lambda phosphatase ...
-
bioRxiv - Bioengineering 2020Quote: Total RNA was extracted from 1 million cells using the Monarch Total RNA Miniprep Kit (NEB, #T2010S). We prepared cDNA from 1 μg of extracted RNA using LunaScript® RT SuperMix Kit (NEB ...
-
bioRxiv - Bioengineering 2020Quote: ... We prepared cDNA from 1 μg of extracted RNA using LunaScript® RT SuperMix Kit (NEB, #E3010). No Template and No Reverse Transcriptase controls (NTC and NRT ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA was prepared from 1 million cells using the Monarch Genomic DNA Purification Kit (NEB, #T3010G). Diagnostic PCR was then carried out followed by gel extraction (NucleoSpin ...
-
bioRxiv - Biophysics 2021Quote: ... and 3 samples from each replicate combined into 7 mL with 1 × T4 DNA Ligase Buffer (NEB), with 1% Triton X-100 ...
-
bioRxiv - Neuroscience 2020Quote: ... Plasmid DNA was digested for 1 hour at 37°C with NcoI (New England BioLabs, Ipswich, MA) unless otherwise specified in a final volume of 20 μl before evaluating restriction fragment patterns by 1% agarose gel electrophoresis ...
-
bioRxiv - Biophysics 2021Quote: Time-resolved experiments with TEV protease were performed by adding 1 μL TEV protease (New England Biolabs) after the 3rd time point to an imaging well containing 100 μL protein sample ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of N protein was dissolved in 36 μL H218O and 2 μL 10x glycobuffer (NEB). To this solution 2 μL PNGase F was added and the reaction mixture was incubated at 37 °C for 16 h ...
-
bioRxiv - Biochemistry 2020Quote: ... and 20 µL of 20 U/µL MNase (New England BioLabs, 1/1000 dilution of commercial stock). Reactions were digested for 1 minute and quenched with 2 µL 500 mM EDTA and thorough pipetting ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was incubated with gentle shaking for 1 h with 10 mL of amylose resin (NEB) pre-equilibrated in 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg of RNA isolate was subjected to rRNA removal with the NEBNext rRNA Depletion Kit (NEB) using the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were set up with 1 μL of genomic DNA and either Q5 DNA Polymerase (NEB) or LongAmp Taq (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and then added up to 5 fmol DNA (2000:1000:1 RNA:protein:DNA ratio) and NEBuffer 3.1 (NEB) to 1X ...
-
bioRxiv - Genomics 2021Quote: ... and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 and 2 (NEB #E7335S, #E7500S), following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5-1 μg of total RNA was reverse transcribed using Protoscript II Reverse Transcriptase (New England Biolabs). Quantitative real-time PCR was carried out using the Light-Cycler 480 SYBR Green I Master (Roche) ...
-
bioRxiv - Biophysics 2022Quote: ... The pooled PCR products were incubated at a 10:1 ratio with DpnI enzyme (New England Biolabs) at room temperature for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... All enzymatic reactions were performed as a 1-step reaction with 1x Glycobuffer 2 (New England Biolabs), 10 μg RBD produced in CHO-S- ...
-
bioRxiv - Biophysics 2022Quote: Cells used for calcium imaging experiments were labeled using 1 µM SNAP-Surface Alexa Fluor 647 (NEB) and 4 µM Oregon Green 488 BAPTA-1 (Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Permeabilized cells were then digested with a final concentration of 1 U/μL of NlaIII (NEB-R0125L) and brought to volume with nuclease-free water to achieve a final 1X digestion reaction buffer in 450μL ...
-
bioRxiv - Neuroscience 2021Quote: ... for samples from library #1 and the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) for samples from library #3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... gently resuspended in fixation buffer (PBS, 0.1% saponin, 4% PFA, RNAsin [New England Biolabs #M0314] 1:20) and incubated for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Fragmentation of 1 µg mRNA aliquots for 5 min at 94°C in 1x Fragmentation Buffer (NEB) was optimal to obtain a pool of 100-200 nt fragments ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total mRNA was prepared from 1 μg total RNA using poly(A) mRNA magnetic isolation reagents (NEB) and fragmented at 94 °C for 15 min ...
-
bioRxiv - Genetics 2019Quote: ... After washing the pellet two times with 1ml of 1 × NEB buffer 2.1 (New England BioLabs (NEB), USA) ...
-
bioRxiv - Genomics 2019Quote: ... Ligation was performed at a 1:3 ratio of pJDrcEPP:library using T4 DNA ligase (New England Biolabs). Ligation product was cleaned-up using a Clean and Concentrator Kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2021Quote: pLenti CMV Hygro DEST (w117-1) was digested with SalI and BamHI (New England BioLabs Inc., MA) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 1 million cells using the Monarch Total RNA Miniprep Kit (NEB, #T2010S). We prepared cDNA from 1μg of extracted RNA using LunaScript® RT SuperMix Kit (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of 5 μM annealed adaptors and 10 μL of Blunt/TA ligase master mix (NEB) was added to each reaction ...
-
bioRxiv - Genomics 2021Quote: ... 10 ng A-tailed gel-isolated PCR product and 1 µl T4 DNA ligase (New England Biolabs) were mixed in a total reaction volume of 10 µl and incubated for 15 min at room temperature ...