Labshake search
Citations for New England Biolabs :
151 - 200 of 244 citations for Corning Hygromycin B Solution since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 10 mL of a 10% BSA solution was incubated with 2.5 μL of Proteinase K (NEB P8107S) for 30 minutes at room temperature (∼22°C) ...
-
bioRxiv - Biochemistry 2023Quote: ... 50 ul of aqueous solution were recovered and treated with 0.3 U of calf intestinal phosphatase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... beads were washed twice with coIP-solution and finally dissolved in RNA protection buffer (New England Biolabs).
-
bioRxiv - Cancer Biology 2023Quote: ... and the samples were incubated overnight at 47℃ in clearing solution comprised of Protease K (NEB, P8107S) and Clearing Premix (Vizgen ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting solution was cooled down to 42°C before adding 2 U of β-agarase (NEB), gently mixing the solution by end-over-tube inversion ...
-
bioRxiv - Biophysics 2024Quote: ... solutions containing polySH3 and cleaved MBP- and His6-tags were passed over Amylose resin (New England Biolabs) to remove excess MBP ...
-
bioRxiv - Neuroscience 2024Quote: ... the samples were cleared overnight at 37°C with a Clearing Solution containing Proteinase K (NEB P8107S) and Clearing Premix (Vizgen 20300003) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissue samples were stored in DNA/RNA stabilizer solution at -80°C (New England Biolabs, Frankfurt, Germany) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... their nuclei were isolated via centrifugation then resuspended in a 0.5 ml solution comprising 1.2 × restriction enzyme NEBuffer™ r3.1 (NEB) containing 0.3% SDS ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were deglycosylated with PNGase F by adding 5μl of a solution consisting of 18μL of Glycobuffer 2 (10x) and 27μL of PNGaseF (NEB, P0708S). Endoproteinase Lys-C (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... The cleaved 6xHis-MBP tag was removed by incubating the solution with Ni-NTA magnetic beads (NEB; S1423) for 1 hour at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... A stock solution of these oligos (1μl of a 10μM) was 5’-end-labeled using T4PNK (NEB®) and 5μl of ATP ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... The wash solution was then replaced with 1× T4 polymerase buffer containing 30 U T4 DNA polymerase (NEB) and incubated at 12 °C for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant solution was incubated for at least 2□h with amylose-affinity chromatography resin (New England Biolabs), whilst gently shaking at 4□°C ...
-
bioRxiv - Microbiology 2024Quote: ... Amplifications were carried out in 20 μl reaction solutions containing 1X Luna® Universal qPCR Master Mix (NEB), 20 ng cDNA and 0.25 μM each gene-specific primer ...
-
bioRxiv - Cell Biology 2024Quote: ... in a reaction solution containing 50 mM sodium phosphate (pH 7.5) and 1% NP-40 (B2704S, NE BioLabs) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: A reaction solution of 100 µL containing 0.32 units/µL Bst DNA polymerase large fragment (New England Biolabs), 0.5 µM forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was initiated by diluting the LbCas12a complexes to a final concentration of 37 nM LbCas12a : 37 nM sgRNA in a solution containing 1X NEBuffer 2.1 (NEB) and 1 µM custom ssDNA reporter substrates in a 40 μL reaction volume ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and resuspended in 50 µL of 1 mg/mL RNAse A solution (New England Biolabs, Ipswich, Massachusetts, United States) and statically incubated at 37 °C for 3 h ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were then resupended in 100 µL Ligase Solution (50mM HEPES pH 7.5, 10 mM MgCl2, 1mM rATP (New England Biolabs), 9.5 nM Connector oligomer (TTTCACGACACGACACGATTTAGGTC ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cells were washed in 800 µL of 1.2X CutSmart solution (from 10X CutSmart stock (NEB, #B7204S, Ispwich, MA)) and pelleted at 900 g for 2 min ...
-
bioRxiv - Genetics 2022Quote: ... Eggs were then injected under air-dry conditions with a solution containing 300ng/μl of recombinant Cas9 Nuclease (NEB) and 100ng/ul each of four sgRNAs targeting the first exon of the Oatp74D gene (S2 Table) ...
-
bioRxiv - Genomics 2022Quote: ... Next, 500 nL of MspJI digestion mix (1x NEBuffer 4, 8x enzyme activator solution, 0.1 U MspJI (NEB, R0661L)) was added to each well and the plates were incubated at 37°C for 4.5 hours ...
-
bioRxiv - Genomics 2020Quote: ... Transformation efficiencies of all strains were monitored and normalised using a stock solution of pLITMUS28 (New England Biolabs, USA). In addition ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Microbiology 2023Quote: 10 μM solutions of each protospacer oligonucleotide were end-phosphorylated with T4 polynucleotide kinase (NEB cat. # M0201, Ipswich, MA) for 30 minutes in the presence of 1x T4 ligase buffer then annealed by heating to 95°C in a heat block which was subsequently allowed to cool to room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by the addition of one µl of Luna Cell Ready Stop Solution 10X (New England Biolabs, Ipswich, MA). We extracted DNA (111 ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified PCR products were ran on 2% agarose gel and stained with ethidium bromide solution (New England Biolabs Inc.). Gel photographs were taken using ChemiDoc MP gel documentation system (BIO-RAD).
-
bioRxiv - Bioengineering 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM DTT (catalog no ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM dithiothreitol (catalog no ...
-
bioRxiv - Biochemistry 2022Quote: ... The samples were treated with 25 µg Proteinase K (1.25 µL of 20 mg/mL stock solution, New England Biolabs) and incubated at 50 °C for 20 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... The beads were resuspended in 30 µl of CIP solution (7.5 U of Quick CIP (M0525L, New England Biolabs) in 30 µl of 1× rCutSmart Buffer (New England Biolabs) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Injection solution was prepared by combining sgRNA with 2 µM Spy Cas9 NLS and 1X NEBuffer (New England Biolabs).
-
bioRxiv - Neuroscience 2024Quote: ... the gel was immersed in 0.3 M sodium acetate solution containing 20 Unit RNase inhibitor (New England Biolabs, M0314L) overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 15 μL of PCR product were mixed with 5 μL of a 5X Exo-SAP solution (15% Shrimp Alkaline Phosphatase – 1000U/ ml – NEB, 10% Exonuclease I – 20000 U/ ml – NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... the ligation of the custom sequence adapters was done in solution by adding 4 μl adaptors (30 μM) and 1600 units T4 DNA ligase (NEB). The ligation was carried at for 2 hours at room temperature on a rotating wheel in 1x ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The solution was directly used as a template for PCR amplification using Q5® High-Fidelity 2X Master Mix (NEB) (primer pair ...
-
bioRxiv - Cell Biology 2021Quote: Cells grown on coverslips were first processed for IF following the protocol described above except all buffers and solution other than the fixative were also supplemented with 10 mM Ribonucleoside Vanadyl Complex (NEB). After incubation with the secondary antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mM sodium ascorbate before collecting them by scraping in 1 mL of the same solution with Murine RNase Inhibitor (1:1000, NEB). Cells were collected in a microcentrifuge tube ...
-
bioRxiv - Biophysics 2021Quote: ... Two experiments were conducted in which the vacuum filling of the channels with buffer was followed by a heating/diffusion step of 1 hour at 40°C with the reservoir filled with a solution containing both DNase I (at 0.096U/μl) and BSA (NEB B9000S) at 0.13mg/ml or 0.40mg/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... a 50 mM stock solution of pervanadate was prepared fresh by mixing equal volumes of 100 mM sodium orthovanadate (New England Biolabs) and 100 mM hydrogen peroxide ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:100 10 mg/mL BSA in distilled water) with 0.75 µL (150 U) micrococcal nuclease enzyme solution (1:10 micrococcal nuclease (NEB, USA) in micrococcal nuclease reaction buffer) ...
-
bioRxiv - Cell Biology 2023Quote: ... To remove RNA secondary structure and anneal the mRNA capture primer 1 μL of tagged random hexamer (100 μM) and 0.5 μL of 10 mM dNTPs (dNTP solution set NEB - N0446S) were added to the sample ...
-
bioRxiv - Microbiology 2023Quote: ... was used as a template for in vitro transcription using Hi-T7 RNA Polymerase and Ribonucleotide Solution Mix (both from New England Biolabs) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... the tissue was incubated in 5 mL of a clearing solution comprising Clearing Premix (Vizgen, PN 20300003) and 50 μL Proteinase K (New England BioLabs) at 37°C in a humidified benchtop incubator until the tissue was cleared.
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Cancer Biology 2023Quote: Fresh omentum and omental HGSOC tumor metastasis biopsy samples were cut into small pieces and dissociated in digestion solution (1 mg/mL collagenase/Dispase [Sigma cat. no. 10269638001], 1 unit/mL DNase I [NEB, cat ...
-
bioRxiv - Systems Biology 2023Quote: ... Whole metagenome sequencing libraries were prepared from 26 µL of DNA solution using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs). The DNA was purified and size selected to remove excess adaptors and adaptor dimers using Ampure XP beads (Beckman Coulter Life Sciences) ...
-
bioRxiv - Bioengineering 2022Quote: 200 nM of isolated smgRNA were injected in a pre-incubating solution of 200 nM Cas9 (S. pyogenes, NEB, M0386), 120 nM fluorescent beacon and 1 U.μL-1 murine RNase Inhibitor (NEB M0314 ...