Labshake search
Citations for New England Biolabs :
51 - 100 of 244 citations for Corning Hygromycin B Solution since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and about 200 ng of DNA was digested with the type II b enzyme BcgI (New England Biolabs). This enzyme cuts both upstream and downstream of the 6 bp recognition site ...
-
bioRxiv - Microbiology 2020Quote: ... The pSAG1:U6-Cas9:sgRNA-TgIF2K-B vector was generated using Q5 site-directed mutagenesis (New England Biolabs) (26 ...
-
bioRxiv - Genetics 2023Quote: ... 1.2 M sorbitol) and resuspended in digestion buffer (Buffer B, 200 mM Vanadyl ribonucleoside complex [VRC from NEB] ...
-
bioRxiv - Microbiology 2023Quote: Five POWV-LI9 fragments were amplified from viral cDNA (Figure 1A,B) using high-fidelity Phusion polymerase (NEB) and corresponding paired primers (Table S2 ...
-
bioRxiv - Genomics 2023Quote: ... nuclei were isolated from fixed B cells and subjected to in situ digestion using 200U MboI (NEB, R0147M) for 4 hours at 37 ºC ...
-
bioRxiv - Evolutionary Biology 2020Quote: A solution of 3.0 μl ThermoPol buffer (New England Biolabs), 1 μl dNTPs (10 mM) ...
-
bioRxiv - Genomics 2021Quote: ... 0.5 μL of 1 mg/mLbovine serum albumin solution (NEB), 1.2 μL of 50 mM NAD+ (NEB) ...
-
bioRxiv - Systems Biology 2022Quote: ... 25μL NEB Next HiFi PCR Mix (2x solution, NEB M0544), 10μl H2O) ...
-
bioRxiv - Genetics 2020Quote: ... solution and amplified by Phusion High-Fidelity DNA Polymerase (NEB) using primers against the edited locus ...
-
bioRxiv - Genomics 2022Quote: ... 1% bovine serum albumin (BSA) solution (NEB, 20 mg/mL). Nuclei were pelleted at 600 RCF for 5 minutes at 4C ...
-
bioRxiv - Plant Biology 2022Quote: ... The extracted RNA solution was treated with DNAse I (NEB) and then cleaned up with the LiCl method mentioned above.
-
bioRxiv - Genomics 2023Quote: ... TET2 reaction was terminated with 0.3 μL stop solution (NEB) and incubation at 37°C for 30 min ...
-
bioRxiv - Genetics 2024Quote: ... Injection solution contained 300 ng/μL spyCas9 protein (NEB, USA), 100 ng/μL kmo-sgRNA ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2020Quote: ... DOM-A and DOM-B K945G mutants were generated by site-directed mutagenesis (New England Biolabs, Cat. No E0554S). For transfection in Drosophila cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was sheared by incubating the nuclei in 100 µl of buffer B supplemented with 1,000 units of micrococcal nuclease (M0247S; NEB) for 30 min at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... Then equal amounts of purified linear A and B PCR products were mixed with the Taq DNA ligase (NEB) and its buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the beads were resuspended in 2X B&W buffer supplemented with 0.4 U/µL RNase Inhibitor (Murine) (NEB, M0314S) to a bead concentration of 5 ug/µL ...
-
bioRxiv - Cancer Biology 2024Quote: ... pET22(b) vector harboring NKp46 construct 22-212 was used to transform chemically competent T7 Express cells (NEB, US) following protocols provided by the manufacturer ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were expressed as N-terminal His6-Smt3 fusion constructs from either pET28-b vectors (expressed in T7 Express lysY/Iq (NEB) Escherichia coli (E ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the clpP2 gene were amplified by PCR using the A–B and C–D primer pairs from table 3 (Phusion polymerase, GC buffer, New England Biolabs). The PCR products were purified with E.Z.N.A ...
-
bioRxiv - Biochemistry 2021Quote: ... 700 bp upstream and downstream were amplified using the A–B and C–CD primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs). The 2×myc tag was added to the B primers as overhangs ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were resuspended in 1 ml of iCLIP lysis buffer B (same as buffer A but with 1% v/v NP-40 and 11 μl of Murine RNase inhibitor (NEB) per 1 ml ...
-
bioRxiv - Immunology 2022Quote: ... ligated in EcoRI-digested pCCLc-MND-X (A kind gift from Dr. Donald B. Kohn) and transformed using NEB-5alpha cells (NEB). Inserts were verified using MND_Input_Verify_F and MND_Input_Verify_R ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from IgG1 stimulated B cells 72 hour post-stimulation using TRIzol reagent (Fisher) and cDNA was prepared using the Protoscript II kit (NEB). Germline transcription was analyzed using quantitative PCR with SYBR Green (Roche ...
-
bioRxiv - Immunology 2022Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human NEBNext Immune Sequencing Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...
-
bioRxiv - Biophysics 2024Quote: ... The gene fragments were individually cloned into sensor plasmid backbones identical to those used in the previous identification of non-functional TetR(B) mutants following the manufacturers protocol for Gibson Assembly (New England Biolabs). The newly constructed plasmids carrying each of the combined mutants were then transformed into E ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1848 bp fragment (containing the 1131 bp Pfcytb open reading frame) was amplified with primers (SI Appendix, Fig. S2A,B) and Phusion DNA polymerase (NEB). PCR product was verified by gel electrophoresis as single band of predicted size ...
-
bioRxiv - Molecular Biology 2023Quote: ... Type I-F Cascade was co-expressed with 6xHis-MBP-TEV-TniQ and a type III-B crRNA in NiCo21 cells (NEB). Cells were then induced with 0.5 mM isopropyl at 18 °C for another 18–20 hours before harvesting ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were then washed three times with buffer B (1.2 M sorbitol and 100 mM potassium phosphate buffer pH 7.5) and resuspended in 500 μL of spheroplast buffer (buffer B containing 20 mM VRC (Ribonucleoside–vanadyl complex NEB #S1402S), and 25 U of Lyticase enzyme (Sigma #L2524 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 nl of a solution containing 10µM EnGen Cas9 NLS (NEB) and 100 ng/µl of gRNAs was injected at the one-cell stage ...
-
bioRxiv - Neuroscience 2022Quote: ... These solutions were added to 100 units of TEV protease (NEB) in aggregation buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... Digestion solution containing proteinase K (8U/mL, New England BioLabs, P8107S) was applied to gels and allowed to digest for 2-16 hours (see Results ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 1 mg/ml bovine serum albumin solution (NEB), 1 μL of hOGG1 (ProSpec TechnoGene Ltd. ...
-
bioRxiv - Microbiology 2021Quote: ... and amplified with OneTaq 2x MasterMix solution (New England Biolabs, MA) mixed with T ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and dNTPs solution mix (Cat. # N0447) from New England Biolabs (NEB). Nuclease free water (Merck ...
-
bioRxiv - Bioengineering 2023Quote: ... 200 uM of deoxynucleotide (dNTP) solution mix (New England Biolabs (NEB), cat# N0447L) ...
-
bioRxiv - Bioengineering 2023Quote: ... 200 uM of deoxynucleotide (dNTP) solution mix (New England Biolabs (NEB), cat# N0447L) ...
-
bioRxiv - Cell Biology 2023Quote: A 40 µL solution of 25% (v/v) amylose resin (NEB) was co-incubated with 500 nM MBP-RH domain and 4 µM Alexa Fluor 647-labeled RAB7A (life technologies ...
-
bioRxiv - Genetics 2024Quote: ... Total mRNA solutions were treated with DNase I (New England Biolabs) to remove any traces of genomic DNA contamination ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... amplification of TcAC1-3xHA was done by PCR using pTREX-n-TcAC1-3xHA plasmid as template and then cloned into pTREX-b by HindIII restriction site using NEBuilder® HiFi DNA Assembly cloning kit (New England Biolabs). Gene cloning was confirmed by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... 26ul 20x SSC solution (InvitrogenTM 15557044) and 15ul RNase inhibitor (NEB M0314L). The 2ml tube was put in 50 °C water bath overnight ...