Labshake search
Citations for New England Biolabs :
151 - 200 of 614 citations for Calcium Channel Voltage Dependent L Type Alpha 1C Subunit CACNA1C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... Remnant wild-type DNA was degraded via DPN1 (New England Biolabs) digestion for two hours at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... coli DNA ligase (NEB, #M0205 L), 5 μl of E ...
-
bioRxiv - Developmental Biology 2020Quote: ... coli DNA Polymerase (NEB, #M0209 L), 1 μl of dNTP (0 .2 mM) ...
-
bioRxiv - Bioengineering 2020Quote: ... BsaI-HF v2.0 (NEB R3733S/L), and T7 DNA Ligase with the same cycling conditions as the part vectors.
-
bioRxiv - Neuroscience 2023Quote: ... The sequencing libraries were generated by Genomescan using the NEBNext Low Input RNA Library Prep Kit from Illumina (New England Biolabs, cat#E6420S/L). In short ...
-
bioRxiv - Immunology 2024Quote: ... Exonuclease I treatment (NEB M0293 L) was used to remove excess primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15□l of 2.1 buffer (NEB), 30 units of SSP1 (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... The mixture was incubated at room temperature for 10 min followed by transformation into 5-alpha competent cells (NEB). The E ...
-
bioRxiv - Microbiology 2020Quote: ... 2μL of the resulting mix was transformed into chemically competent Escherichia coli (High efficiency DH5-alpha, New England Biolabs) according to manufacturer’s instructions and cultured for 16 hours on Luria broth (LB ...
-
bioRxiv - Microbiology 2021Quote: ... and npmA F and npmA_R, respectively (Table S5) Assembled vectors (Figs. S4C, S4D) were transformed into NEB 5-alpha (New England Biolabs), selecting for ampicillin and gentamicin resistance ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Each library was split in two and transformed separately into 5-alpha cells (NEB, 3.5uL DNA in 35uL cells). Plasmid library isolation ...
-
bioRxiv - Neuroscience 2020Quote: ... The M1879T mutant channel was constructed using site-directed mutagenesis PCR (Forward primer: AATACAGACGGAAGAGCGATTCATGGCATCAAACCC; Reverse primer: GCTCTTCCGTCTGTATTCGAAGGGCATCCATCTCTCC) with Q5 polymerase (New England Biolabs, Ipswitch, MA). The neonatal construct differed from the adult by inclusion of the neonatal exon 6N instead of the adult exon ...
-
bioRxiv - Neuroscience 2022Quote: Insertion of point mutations in mPiezo2 and the chimeric channel mP1/mP2 were carried out using the Q5® Site-Directed Mutagenesis Kit (NEB, Inc) according to the manufacture’s indications ...
-
bioRxiv - Neuroscience 2020Quote: ... Golden Gate Assembly protocol was applied with type IIS endonuclease Esp3I (NEB). The product was transformed into competent E ...
-
bioRxiv - Immunology 2023Quote: ... standard restriction cloning using the Type IIS restriction enzyme BsmBI-v2 (NEB) was employed to insert the leader peptides and variable regions into pVITRO1 (mouse IgG1 κ) ...
-
bioRxiv - Genomics 2021Quote: ... The reactions were combined and 2.5 μL of the assembly reaction or a control reaction without amplicon were used to transform NEB5-alpha cells (New England Biolabs) to measure background assembly ...
-
bioRxiv - Biochemistry 2022Quote: ... The following cloning strains were used: NEB Stable (lentiviral and piggybac vectors) and NEB 5-alpha (all other plasmids) (New England Biolabs). For cloning of base editor constructs ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids carrying the dcas9/lacI cassette were recovered and propagated in the NEB 5-alpha F’ Iq strain (New England Biolabs). Cloning and/or propagation of plasmids containing the dcas9/lacI cassette in host E ...
-
bioRxiv - Molecular Biology 2022Quote: ... following the manufacture’s protocol. Plasmids were transformed in DH5-alpha or DH10-beta chemo-competent Escherichia coli (E. coli) cells (New England Biolabs). Transformed bacteria were grown in LB medium supplemented with 50 μg/mL kanamycin or 100 μg/mL carbenicillin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 μ L of Protoscript II Reverse Transcriptase (200U/μ L, Catalog No. M0368, New England BioLabs Inc.), 2 μ L of 0.1M dithiothreitol (DTT) ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA ligase (NEB, Cat. #M0205 L), 5 μl of E ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA Polymerase (NEB, Cat. #M0209 L), 1 μl of 10mM dNTP (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... and T7 DNA Ligase (NEB M0318S/L) with the same cycling conditions as the part vectors.
-
bioRxiv - Bioengineering 2023Quote: ... 10 mM (NEB, cat. no. N0447S/L)
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... or Amylose Resin (NEB, 1 L, USA), that had been prewashed with respective lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.5□l of 10m/ml BSA (NEB), 15□l of 2.1 buffer (NEB) ...
-
bioRxiv - Genetics 2019Quote: ... coli was performed using DH5-alpha or its commercial derivative NEB 10-Beta (New England Biolabs product number C3019I or C3020). Genomic DNA of BY4741 ...
-
bioRxiv - Microbiology 2019Quote: ... Colonies were selected using a gentamycin marker and blue/white colony screening in a background of dH5-alpha cells (New England Biolabs, UK). The resulting construct was transformed into PA14 and the clone used for assays was verified by Sanger sequencing (University of Sheffield ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (fhuA2∆(argF-lacZ)U169 phoA glnV44 ϕ 80∆(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17) (New England Biolabs) was used for the initial two-plasmid assay ...
-
bioRxiv - Molecular Biology 2020Quote: The wild-type fragments were amplified with Phusion High-Fidelity DNA Polymerase (NEB) using HEK293T cDNA ...
-
bioRxiv - Cell Biology 2019Quote: Purified Wss1 wild type (3.1 μM) was mixed with purified histone H3 (NEB) (3.3 μM ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10,000 units Type IIs restriction enzymes (T7 DNA ligase, Esp31/BsaI-v2, NEB), and 1 μL T4 DNA ligase (NEB ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Freshly laid wild-type TU-strain embryos were injected with SpCas9 protein (NEB) mixed with gRNAs (~300 ng/ul) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... In the second Type IIS DNA assembly reaction using BbsI (New England Biolabs), these transcriptional unit constructs were assembled into the backbone plasmid pML3001 (Lebovich and Andrews 2022 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of Universal nuclease (Pierce; 125U/L of culture) and 10 μl of DNaseI (NEB; 20U/L of culture) were added and the mixture allowed to incubate for 10 min at RT ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 l of the DNA was used in a 50 l PCR reaction with the enzyme Q5 polymerase (New England Biolabs) and the primers Cytb-f AGTCCTAGTGTAATGGAAGCand Cytb-r ATCTTCAACGTGTTTAGCACC (annealing temperature 61.5°C) ...
-
bioRxiv - Microbiology 2021Quote: ... L: 100 bp DNA Ladder (New England Biolabs). 1 ...
-
bioRxiv - Bioengineering 2023Quote: T4 Polynucleotide Kinase (NEB cat. no. M0201S/L)
-
bioRxiv - Bioengineering 2023Quote: Bsu36I restriction enzyme (NEB cat. no. R0524S/L)
-
bioRxiv - Cell Biology 2022Quote: ... and transformed into competent DH5a E. coli (5-alpha Competent E. coli) following the protocol provided by the company (New England Biolabs, Ipswich, MA). For colony selection ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 uL of the Gibson Assembly reaction mixture was transformed via heat shock into chemically competent NEB 5-alpha cells (NEB, Catalog #C2988J), and cells were incubated on lysogeny broth with 10 μg/mL tetracycline (LB-Tet10 ...
-
bioRxiv - Microbiology 2021Quote: ... The amplicon was cloned into the pTXTL-T7p14-aH plasmid (replacing alpha hemolysin, Daicel Arbor Biosciences, Ann-Arbor, MI) using NcoI-HF and SmaI (New England Biolabs, Ipswitch, MA). The new plasmid construct (pSLP15 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Molecular Biology 2021Quote: pUC19 was digested using thirteen commercially available Type II restriction enzymes (New England Biolabs). For BamHI ...
-
bioRxiv - Bioengineering 2022Quote: ... The template DNA was removed by using DpnI type IIM restriction enzyme (NEB, USA) at 37°C (1 – 2 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... and/or 10 U of T4 PNK (wild-type or 3’ phosphatase minus, NEB). For RtcB ligation ...
-
bioRxiv - Biophysics 2022Quote: ... type IIS enzymes (BsaI, New England Biolabs #R3733, and BsmBI, New England Biolabs #R0739) were used to iteratively concatenate sequence modules ...