Labshake search
Citations for New England Biolabs :
51 - 100 of 614 citations for Calcium Channel Voltage Dependent L Type Alpha 1C Subunit CACNA1C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... The libraries were transformed into 5-alpha electrocompetent cells (NEB) and grown in liquid culture ...
-
bioRxiv - Systems Biology 2021Quote: ... The libraries were transformed into 5-alpha electrocompetent cells (NEB) and grown in liquid culture.
-
bioRxiv - Biophysics 2022Quote: ... Toxicity-resistant strains such as NEB 5-alpha F’Iq (NEB) and ABLE K (Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... coli dam+/dcm+ (NEB 5-alpha competent E. coli, #C2987) and dam−/ dcm− (dam−/dcm− competent E ...
-
bioRxiv - Biochemistry 2022Quote: ... T4 DNA ligase and chemically competent DH5 alpha cells (NEB); Alt-R CRISPR-Cas9 crRNA ...
-
bioRxiv - Microbiology 2021Quote: ... coli DH5-alpha cells following manufacturer’s protocol (New England Biolabs). Sanger sequencing was used to confirm plasmid construction ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NEB® 5-alpha F’IQ (New England Biolabs, NEB) were used for routine cloning procedures and chemically competent E ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NEB® 5-alpha F’IQ (New England Biolabs, NEB) were used for routine cloning procedures and chemically competent E ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Assembled products were heat-shock transformed to 5-alpha (NEB), TOP10 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... NEB 5-alpha competent E.coli (NEB #C2987H, Ipswich, MA, USA) were transformed with ligated plasmid by heat shock at 42°C for 30 seconds ...
-
bioRxiv - Biochemistry 2023Quote: ... Assembled plasmids were transformed into NEB 5-alpha F’Iq (NEB) and standard chemically competent Escherichia coli transformation protocols were used to construct plasmid host strains ...
-
bioRxiv - Genomics 2023Quote: ... The library was transformed into 5-alpha electrocompetent cells (NEB), grown in liquid culture ...
-
bioRxiv - Genomics 2023Quote: ... The libraries were transformed into 5-alpha electrocompetent cells (NEB). The plasmid library was prepared by maxi-prep (Sigma) ...
-
bioRxiv - Bioengineering 2024Quote: ... grown in 5-alpha competent Escherichia coli (NEB, Ipswich, MA) and purified using the PureYield MidiPrep System (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... Escherichia coli competent cells NEB 5-alpha (C2987, New England Biolabs), NEB Stable (C3040 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were transformed into either competent NEB 5-alpha F’Iq (NEB) or Epi400 (Lucigen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and were performed using 5-alpha F’ Iq cells (NEB C2992H).
-
bioRxiv - Biochemistry 2021Quote: ... The assembled product was transformed into 5-alpha competent cells (NEB) and the insert sequence was confirmed by Sanger sequencing (Source Bioscience) ...
-
bioRxiv - Developmental Biology 2022Quote: ... it was transformed into NEB 5-alpha competent E.coli (NEB #C2987). The sequence of donor plasmid was confirmed by Sanger sequencing using 5 primers to ensure that there are no disabling mutations in the scarless DsRed cassette or regions of the homology arms ...
-
bioRxiv - Immunology 2022Quote: ... and then transformed in NEB 5-alpha competent cells (NEB, C2987U). Expi293F (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... coli host strain NEB 5-alpha F’ lq (New England Biolabs) was exclusively used to generate ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transformed into NEB 5-alpha cells (New England Biolabs) and plated on LB plates with carbenicillin for selection purposes and incubated overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then transformed into 5-alpha competent Escherichia coli cells (NEB), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosomes with a spytag labeled L17 subunit was used during in vitro translation system (NEB, E3313S) to generate the stalled RNC ...
-
bioRxiv - Genomics 2020Quote: ... the channels were cleaned up by 1X NEB buffer 3.1(New England Biolabs) with 1% RNase inhibitor (Enzymatics ...
-
bioRxiv - Microbiology 2024Quote: ... Single-construct plasmids expressing A-subunits were constructed via restriction digestion (NdeI and PstI, New England Biolabs) and ligation using pBAD24 (Amp+ ...
-
bioRxiv - Microbiology 2021Quote: ... Clones were selected and maintained in E.coli strain NEB5-alpha (NEB, C2987I). All constructs were verified by Sanger sequencing (Eurofins) ...
-
bioRxiv - Microbiology 2021Quote: ... Ligations were used to transform NEB 5-alpha competent cells (NEB C2987H) and the cloned spacer was verified by Sanger sequencing using primer PSP108 ...
-
bioRxiv - Microbiology 2021Quote: ... Assemblies were transformed into DH5-alpha chemically competent cells (New England Biolabs) and correct clones were identified by restriction profile and Sanger sequencing (Genewiz ...
-
bioRxiv - Molecular Biology 2020Quote: ... transformed into NEB 5-alpha chemically competent Escherichia coli (New England BioLabs), and submitted for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was transformed into NEB 5-alpha high efficiency competent cells (NEB). Insert size was verified with PCR and purified plasmids were sequenced using Sanger sequencing.
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Systems Biology 2023Quote: ... Each construct was transformed into standard 5-alpha competent bacteria (#C2987; NEB) grown overnight in in 500 ml of standard Luria Broth (LB ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli competent cells (NEB 5-alpha, New England Biolabs, Ipswich, MA, USA) that were cultured and prepared using a GenElute HP Plasmid Midi kit (NA0200-1KT ...
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Type IIs RE (0.5 μl, NEB), vector backbone and inserts were combined to make 10 μl ...
-
bioRxiv - Microbiology 2019Quote: ... 1 mM calcium chloride and 200 unit/ml final concentrations of micrococcal nuclease (NEB). Cell lysates were incubated at 25 ℃ for 15 minutes before adding 3 mM final concentration of EGTA was added.
-
bioRxiv - Neuroscience 2019Quote: ... was first transformed into NEB 5-alpha competent cells (New England Biolabs #E2621S) and plated on LB plus ampicillin (60 µl/ml).
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2023Quote: ... NEB Stable (lentiviral vectors) and NEB 5-alpha (other plasmids) (New England Biolabs) were used as cloning strains ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids were then transformed into DH5-alpha high-efficiency competent cells (NEB). Following transformation ...
-
bioRxiv - Neuroscience 2024Quote: ... TurboID was fused at the C-terminus of PSD95 and inserted into a cre-dependent AAV expression vector under the synapsin promoter by Gibson assembly (NEB). Plasmids will be deposited at plasmids.eu.
-
bioRxiv - Biochemistry 2024Quote: ... a pET-derived vector that is normally used for T7 RNA polymerase-dependent protein expression (AVA421) was linearized by digestion with XbaI (NEB) in a reaction containing 1X CutSmart buffer and 0.5 U/μl XbaI to be used for run-off transcription using T7 RNA polymerase to transcribe the first 26 nucleotides following the T7 promoter sequence to generate the standard model RNA substrate ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Wild type ϕ29 was purchased from NEB as positive control ...
-
bioRxiv - Biophysics 2022Quote: ... type IIS enzymes (BsaI, New England Biolabs #R3733 ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNAse type IV (New England Biolabs/ Bioconcept) in DMEM/F12 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... To perform in vitro phosphorylation 5 μg of purified GST-NL2CT (WT or S714D) fusion protein was incubated with 2.5kUnits purified catalytic subunit of PKA (NEB) supplemented with 200 μM ATP at 30°C for the indicated time points.
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs encoding each of the CBAF subunits were PCR-amplified using Phusion DNA polymerase in HiFi Phusion buffer (NEB) and subcloned into pLibMam vectors using NEBuilder HiFi (NEB ...