Labshake search
Citations for New England Biolabs :
151 - 200 of 2005 citations for 4F2 Cell Surface Antigen Light Chain SLC7A5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and the polymerase chain reaction (PCR) was used to amplify DNA fragments with Phusion polymerase (New England Biolabs) of the genomic sequence using a forward primer that starts from 2199 bases upstream of the ATG start codon of zipt-2.3 and a reverse primer that contained the codon preceding the stop codon of zipt-2.3 and the coding sequence of the T7 epitope (MASMTGGQQMG) ...
-
bioRxiv - Microbiology 2022Quote: ... polymerase chain reaction (Q5 High-Fidelity 2x Master Mix and OneTaq, Quick-Load 2X Master Mix, both NEB), PCR clean-up (Monarch PCR and DNA Cleanup Kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by a 12-cycle polymerase chain reaction (PCR) using high-fidelity Phusion DNA Polymerase (New England BioLabs). DNA amplification was confirmed using Qubit fluorometry ...
-
bioRxiv - Genomics 2023Quote: ... were amplified by polymerase chain reaction (PCR) with the Phusion High-fidelity DNA Polymerase (New England Biolabs #M0530L), then both amplicons were assembled by Gibson assembly to produce the desired CRISPRoff-mScarletI plasmid.
-
bioRxiv - Biochemistry 2023Quote: ... Polymerase chain reactions (PCRs) were conducted with Q5® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, USA), PCR purifications with the Monarch® PCR & DNA cleanup kit (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: Polymerase chain reactions (PCRs) for cloning purposes were performed using the high fidelity Phusion DNA Polymerase (NEB, France). PCR products were purified with the NucleoSpin PCR Clean Up kit (Macherey Nagel ...
-
bioRxiv - Cell Biology 2023Quote: Polymerase chain reaction (PCR) was performed using the Phusion Hot Start Flex 2X Master Mix (New England Biolabs). Reactions were set up according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Surface biotinylated proteins immobilized on streptavidin agarose beads were denatured in Denaturing Buffer (New England Biolabs) at 100°C for 10 min in accordance with the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... Cut14-SNAP was stained with 0.2 μM of SNAP-Surface Alexa Flour 647 (New England BioLabs) in PEM buffer for 15 minutes at 25 °C ...
-
bioRxiv - Systems Biology 2022Quote: ... Snap-EGFR was labeled with 0.5 μM Snap-Surface Alexa647 (New England Biolabs GmbH, Frankfurt, Germany) for at least 60’ ...
-
bioRxiv - Immunology 2020Quote: ... Linker insertion and modifications in the antigen-bearing components were achieved using Q5 Site Directed Mutagenesis Kit (NEB). Custom DNA primers produced by Integrated DNA technologies (IDT) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The polymerase chain reaction (PCR) products were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs, MA, USA) with strict accordance to the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Polymerase chain reaction (PCR) products and plasmids were purified using Monarch® PCR & DNA Cleanup Kit (New England Biolabs) and Sanger sequencing was performed by Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2019Quote: ... bovis C9.1 gDNA by polymerase chain reaction (PCR) with Phusion High-Fidelity DNA Polymerase (New England BioLabs; Beverley, MA) using primers EAM6 and EAM18 ...
-
bioRxiv - Synthetic Biology 2021Quote: Sub-parts (modules, Supplemental Table 1) were amplified via high-fidelity polymerase chain reaction (PCR) (New England Biolabs #M0491S) using dsDNA templates and ssDNA primers listed in Supplemental Table 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the circular fragments were amplified by two rounds of polymerase chain reaction (PCR) with Q5-High Fidelity polymerase (NEB). Both PCR rounds begin with an initial denaturation at 98 °C for 30 s ...
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction or gBlock synthesis (IDT) and assembled using HiFi assembly (New England Biolabs) according to the manufacturer’s instructions as shown in Table 1 ...
-
bioRxiv - Biophysics 2023Quote: ... Purified SNAP-mDia1 was incubated with 5x excess of SNAP-surface-649 dye (New England Biolabs, USA) overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Btk-SNAP was combined with a 1.5x molar excess of SNAP-Surface Alexa488 dye (NEB, Cat# S9129S) and incubated overnight at 4ºC ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction (PCR) was performed on a genomic rat DNA template using a Taq PCR Kit (New England Biolabs), and the subsequent PCR product was purified using a Qiagen PCR Purification Kit (Life Technologies ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction was performed using a 50 µL master mix consisting of 1x standard Taq buffer (New England Biolabs), LCO1490 primer (0.2 mM) ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses were performed using Luna Universal Probe One-Step qRT-PCR Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions were performed with 15 μL Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA), 0.2 μM of forward primer ...
-
bioRxiv - Biochemistry 2020Quote: ... Synthesized first-strand complimentary DNA was used to amplify the heavy-chain variable domains using Q5 high-fidelity DNA polymerase (New England Biolabs) and the described primers (CALL001 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the templates were prepared by polymerase chain reaction (PCR) amplification from corresponding plasmid constructs using Q5 DNA Polymerase Master Mix (NEB). The PCR reaction was worked up using a Qiagen PCR purification kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genes were amplified in polymerase chain reactions (PCRs) using oligonucleotides with XhoI and KpnI restriction site overhangs and digested with the respective enzymes (NEB). pcDNA3.1 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... The DNA was isolated from the supernatant using the polymerase chain reaction (PCR) clean-up kit (New England Biolabs®) and quantified using a nanodrop ...
-
bioRxiv - Cell Biology 2021Quote: ... these fragments were amplified by Polymerase Chain Reaction using Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs (NEB)) using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers ...
-
bioRxiv - Cell Biology 2022Quote: ... The pDyn1 plasmid [the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to an amino-terminal His-ZZ-TEV tag and a SNAPf tag (New England Biolabs) on the carboxy-terminus] and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Systems Biology 2020Quote: ... Open Reading Frames (ORFs) were amplified by polymerase chain reaction (PCR) from the templates indicated in Table S7 using Phusion DNA polymerase (NEB) with Gateway compatible sequences appended to the end of the primers (5’ sequence - gggg aca act ttg tac aaa aaa gtt ggc acc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 25–50 ng of template DNA was added to Polymerase Chain Reactions (PCR) containing 1× Standard Taq Buffer (New England Biolabs), 2.5 mm MgCl (New England Biolabs) ...
-
bioRxiv - Biophysics 2019Quote: ... All the p53[R273] point mutations are done using overlap extension polymerase chain reaction by primers which are shown in Table S2 and then digested with Nde1(NEB) & BamH1(NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Tetravalent antibody constructs were generated by fusing these fragments with their respective IgG heavy chain in the pSCSTa mammalian expression vector using Gibson assembly (NEB). Fab-IgG constructs were arranged by fusing a heavy chain Fab domain to the N-terminus of the IgG via a S(G4S)3 linker ...
-
bioRxiv - Synthetic Biology 2020Quote: ... inverted PgolB promoter with Bxb1 recognition sites and reporter-terminator (GFP-rrnBT1) pair were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (M0491, NEB) in thermal cycler (C1000 Touch ...
-
bioRxiv - Microbiology 2021Quote: ... All polymerase chain reactions were performed using 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of each forward and reverse primer and 10 ng of DNA template ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Pathology 2021Quote: Reverse-transcription polymerase chain reaction (RT-PCR) was performed using the Luna Universal Probe One-Step RT-qPCR kit (NEB). Two gene targets were used for SARS-CoV-2 RNA detection ...
-
bioRxiv - Bioengineering 2022Quote: All gene amplifications were performed using polymerase chain reaction (PCR) in a 50 µL mix with Q5 High-Fidelity DNA Polymerase (New England Biolabs) according to the manufactureŕs protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Immunology 2022Quote: Fab fragments were generated by inserting a stop codon six amino acids upstream of the hinge region (CPPCP) of the heavy chain expression plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). This mutagenized plasmid was co-transfected with the respective light chain plasmid ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We amplified the wild-type EST1 gene from the genome of the haploid strain BY4742 by polymerase chain reaction (PCR) using the high-fidelity Q5 polymerase (NEB) and inserted it into the ΔEST1 cells used in [1] by CRISPR/Cas9 editing ...
-
bioRxiv - Neuroscience 2022Quote: ... The heavy-chain variable domain was then amplified from the cDNA using Q5 high-fidelity DNA polymerase (New England Biolabs) with the described primers (CALL001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The isolated DNA and the initial infectious plasmid were used as DNA template for polymerase chain reaction (PCR) using 30 cycles and the Q5 High Fidelity DNA Polymerase (New England BioLabs) under the recommended conditions by the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by polymerase chain reaction (PCR) using isopropanol-precipitated genomic DNA as template and OneTaq DNA polymerase (New England Biolabs, (NEB), #M0480 ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Genetics 2023Quote: ... The presence of infectious rIBV in the allantoic fluid was confirmed by a two-step reverse transcription polymerase chain reaction (RT-PCR) protocol using Protoscript II reverse transcriptase (NEB) and the random primer 5′-GTTTCCCAGTCACGATCNNNNNNNNNNNNNNN-3′ for the RT step and recombinant Taq polymerase (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragments were amplified using ligation-mediated polymerase chain reaction (LM-PCR) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) to allow the addition of homology arms necessary for cloning ...