Labshake search
Citations for New England Biolabs :
101 - 150 of 2005 citations for 4F2 Cell Surface Antigen Light Chain SLC7A5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were incubated with 200 nM SNAP-Surface® Alexa Fluor® 488 (New England Biolabs, UK, diluted in serum-free DMEM/F12), for 30 min at 37°C with 5% CO2 ...
-
bioRxiv - Genetics 2021Quote: MBP-Stwl antigen was purified from induced bacterial culture using Amylose Resin (NEB: E8021L). Briefly ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 µM NGFR121W-SNAP was coupled with 3 µM BG549 surface (NEB # S9112) for 1 hour at 37°C in calcium imaging (CIB ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions (PCR) were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and gel-purified products (hph and the gene of unknown function with 73% homology to an AAC(2’)-IIa resistance gene ...
-
bioRxiv - Microbiology 2019Quote: ... Polymerase Chain Reaction (PCR) was conducted following standard conditions outlined by New England Biolabs (NEB) (Ipswich ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 genes by polymerase chain reaction (PCR) using Phusion® HF (New England Biolabs). PCR products were gel extracted and sequenced to determine the full-length P ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all linear polymerase chain reaction (PCR) products (Q5 High-Fidelity DNA Polymerase, New England Biolabs) were extracted by gel extraction and then ligated using NovoRec plus One step PCR Cloning Kit (Novoprotein) ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: Human ARHGAP18 constructs were created using Polymerase Chain Reaction (PCR) using New England Biolabs (NEB) Phusion High-Fidelity PCR Kit (catalog no ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Polymerase chain reactions (PCRs) were carried out with Q5 Hot Start High-Fidelity DNA polymerase (NEB). Colony PCRs were performed with Taq polymerase (NEB) ...
-
bioRxiv - Systems Biology 2020Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again with a GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... The polymerase chain reaction (PCR) was performed with “Taq DNA Polymerase with Standard Taq Buffer” (NEB) according to company’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Polymerase chain reactions (PCRs) were conducted using Q5 High-Fidelity 2x Master Mix (New England Biolabs) in the presence of 0.5 µM of forward and reverse primers in a volume of 25 µL ...
-
bioRxiv - Biochemistry 2020Quote: ... The polymerase chain reaction (PCR) included 1-unit Phusion High-Fidelity DNA Polymerase (New England Biolabs), 1x Phusion buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... pDONR/Zeo plasmid was linearized via Polymerase Chain Reaction (PCR) with the Q5 DNA polymerase (NEB) and a pair of primers for each Cac1 mutant that anneal to the sequences flanking the section to be modified (Supplementary Table 2) ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... Template DNAs were prepared by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (NEB) with the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... and fragments were generated by polymerase chain reaction (PCR) using Phusion High-Fidelity Polymerase (M0530L, NEB) using 35 cycles and 60°C annealing temperature ...
-
bioRxiv - Bioengineering 2024Quote: All polymerase chain reactions were performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) and all primers were synthesized by IDT (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... dCas9-SNAP protein samples were incubated with SNAP-Surface Alexa Fluor 647 (NEB S9136) at 37°C for 30 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:1000 concentrations of SNAP-Surface 488 (NEB #S9124, New England Biolabs, Ipswich, MA), TMR Halo (G8252 ...
-
bioRxiv - Bioengineering 2019Quote: Deglycosylation of yeast surface displayed tau was performed using PNGase (New England Biolabs (NEB), Cat ...
-
bioRxiv - Bioengineering 2019Quote: Deglycosylation of yeast surface displayed tau was performed using PNGase (New England Biolabs (NEB), Cat ...
-
bioRxiv - Immunology 2019Quote: ... or SEE together with 1 µM CLIP-Surface 647 (Figure 3C, NEB, catalog S9234S) in RPMI medium for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: The full-length PLCγ1 was labeled with SNAP-Surface Alexa Fluor 647 (NEB, S9136S). Briefly ...
-
bioRxiv - Biophysics 2020Quote: ... This was followed by fixation with PFA and staining with SNAP-Surface AlexaFluor647 (NEB) at 4 µM concentration for SNAP-EAP45 and DAPI for nuclei on the following day ...
-
bioRxiv - Neuroscience 2022Quote: Recombinant proteins were labeled with SNAP-Surface 549 dye (New England BioLabs, Cat# S9112S) for visualization ...
-
bioRxiv - Biophysics 2022Quote: ... purified proteins were labelled with SNAP-Surface Alexa Fluor 647 tag (New England Biolabs) following manufacturer’s instructions.
-
bioRxiv - Biophysics 2022Quote: ... A fraction of dynein molecules was labeled with SNAP-surface 649 (New England Biolabs) and purified using micro Bio-spin P30 gel filtration columns (33 ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified protein was labeled with SNAP-Surface Alexa Fluor647 dye (New England Biolabs). The fractional dye labeling and DNA binding activity were assessed as previously described [12].
-
bioRxiv - Neuroscience 2022Quote: ... The chemical substrates were SNAP- tag ligands (SNAP surface 549 - BG 549 [NEB, S9112S]) and CLIP-tag ligands (CLIP surface 647 - BC 647 [NEB ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... stained in HI buffer containing 5 μM SNAP-Surface Alexa 647 (New England Biolabs) for 15 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: Antigen binding fragment (Fab) was generated by incubating IgG with LysC (New England Biolabs, Cat# P8109S) at a ratio of 1 μg LysC per 10mg IgG at 37°C for 18hrs ...
-
bioRxiv - Immunology 2020Quote: ... Antigen binding fragment (Fab) was generated by incubating IgG with LysC (New England Biolabs, Cat# P8109S) at a ratio of 1μg LysC per 10mg IgG at 37°C for 18hrs ...
-
bioRxiv - Bioengineering 2021Quote: ... GFP and taCA were cloned by polymerase chain reaction (PCR) using pMAL-c5X (New England Biolabs, USA), pGEX-4T-1 (GE Healthcare ...
-
bioRxiv - Immunology 2019Quote: ... Polymerase chain reactions (PCR) for cloning steps were performed with Phusion High Fidelity polymerase (New England Biolabs). KHNYN-2 (NM_001290256 ...
-
bioRxiv - Microbiology 2021Quote: ... All fragments were amplified by polymerase chain reaction (PCR) using Q5 DNA polymerase (New England Biolabs, USA). Fragments to be ligated contained regions of 20-30 bp of homology ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers were used in a polymerase chain reaction (PCR) with 2X Phusion Master Mix (New England Biolabs) and the appropriate parent plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was amplified in two stages of Polymerase Chain Reaction (PCR) using Q5 DNA polymerase (NEB). For the first PCR reaction ...
-
bioRxiv - Genomics 2023Quote: ... Real-time polymerase chain reaction (PCR) was performed using Luna® Universal qPCR Master Mix (NEB M3003L) and the Bio-Rad CFX96 Touch Real-Time PCR Detection System (Bio-Rad 1845097) ...
-
bioRxiv - Biochemistry 2024Quote: Point mutants were generated using inverse polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs) or Herculase II (Agilent) ...
-
bioRxiv - Bioengineering 2024Quote: All polymerase chain reaction (PCR) amplification steps were performed using Phusion DNA polymerase (NEB, Whitby, Ontario, Canada). Primers used for PCR amplification were ordered from Integrated DNA Technologies (IDT ...
-
bioRxiv - Cell Biology 2019Quote: ... The bead-bound protein was incubated with 3 µM SNAP-Surface Alexa Fluor 647 (NEB) for 40-60 min at 4°C (to fluorescently label the protein) ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was labeled with SNAP-Surface Alexa Fluor 647 labeling kit (New England Biolabs) according to the protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... the nuclear extract was incubated with 0.4 μM SNAP-surface 549 (New England BioLabs, #S9112S) or HALO-JF646 (Luke Lavis ...
-
bioRxiv - Biochemistry 2023Quote: ... protein was combined with 1.5x molar excess of SNAP-Surface Alexa488 dye (NEB, Cat# S9129S). SNAP dye labeling was performed in buffer containing 20 mM Tris [pH 8.0] ...
-
bioRxiv - Immunology 2019Quote: ... The generated cDNA was used as template for amplification of the emact full transcript using the primer pair Emact_Dw x Emact_Up by high fidelity polymerase chain reaction (Phusion, NEB). Resulting amplicons were sub-cloned into the pDrive cloning vector (QIAGEN ...