Labshake search
Citations for New England Biolabs :
51 - 100 of 2005 citations for 4F2 Cell Surface Antigen Light Chain SLC7A5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... Enzymatic antigen retrieval with proteinase K (Biolabs, 2μg/mL) was used prior to incubation with antibodies ...
-
bioRxiv - Biophysics 2022Quote: Cells used for calcium imaging experiments were labeled using 1 µM SNAP-Surface Alexa Fluor 647 (NEB) and 4 µM Oregon Green 488 BAPTA-1 (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: FLAG-TEV-SNAP-Ago2 expressed in HEK293T cells was labeled with SNAP-Surface Alexa Fluor 647 (NEB) and immunopurified by an anti-FLAG antibody conjugated onto Dynabeads Protein G (Invitrogen) ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... Purified SNAP-CP was incubated with 5x excess of SNAP-surface-549 dye or SNAP-surface-649 dye (New England Biolabs, USA) overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were incubated with 2 nM benzylguanine-Alexa Fluor 647 (New England Biolabs, SNAP-Surface Alexa Fluor 647) or custom synthesized SNAP substrate benzylguanine-DY549P1 for 30 min before an experiment ...
-
bioRxiv - Immunology 2019Quote: ... and SNAP-Surface Alexa Fluor 647 (NEB, catalog S9136S) at 37 °C/ 5% CO2 for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... and SNAP-Surface 647 (1 μM, New England Biolabs) for 60 minutes at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... or SNAP-Surface Alexa Fluor647 (New England Biolabs S9136S), respectively ...
-
bioRxiv - Biophysics 2020Quote: ... permeabilised and stained with the SNAP-Surface AlexaFluor647 (NEB) at 4 µM for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... SNAP-Surface Alexa Fluor 647 (S9136S, New England Biolabs), SNAP-Surface ATTO488 (S9124S ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 8 µM BC-647 (CLIP-Surface 647, NEB) in a base solution of Passive Lysis Buffer was rotated overnight at 4°C to label CLIP-tagged proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 μM of SNAP-Surface Alexa Fluor 647 (NEB) was added and incubated for another 30 min on ice to saturate the remaining SNAP-tag binding sites ...
-
bioRxiv - Immunology 2022Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human NEBNext Immune Sequencing Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... we quantitated the proportion of abnormal DNA fragments generated by the procedure using DNA prepared from the transfected cell population and a polymerase chain reaction (PCR)-based T7 endonuclease assay (New England BioLabs). The PCR was performed with primers flanking the predicted ligation-junction product (forward primer AGAATACCAGGGGGCCATGA and reverse primer AACGAATCCTTTCCCTGGGTC) ...
-
bioRxiv - Microbiology 2022Quote: ... the template chain was digested using DpnI restriction endonuclease (NEB, USA). Afterward ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerase chain reactions (PCRs) were performed using Phusion DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reaction (PCR) was performed with Phusion DNA polymerase (NEB) in a total volume of 50 µl in GC buffer containing 10% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified from mouse cDNA by polymerase chain reaction (NEB, M0492L) using primers below:
-
bioRxiv - Cell Biology 2021Quote: ... were performed by confocal microscopy in cells previously labelled with the indicated SNAP-Surface fluorescent probe (New England Biolabs) using a Zeiss LSM-780 microscope with a 63X / 1.4 NA oil objective from the FILM Facility ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 µM of SNAP-Surface Alexa Fluor 647 (NEB) in extracellular buffer for 30 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The benzylguanine (BG)-conjugated AF647 (SNAP-Surface; NEB; cat.# S9136S) was diluted to 1 μM in blocking solution (0,5% (w/v ...
-
bioRxiv - Biophysics 2023Quote: SNAP-Surface BG-AF647 (New England Biolabs, cat. no. S9136S)
-
bioRxiv - Synthetic Biology 2020Quote: ... Polymerase chain reactions were performed with Q5 DNA Polymerase (NEB, Ipswich, MA). pSMART-HC-Kan (Lucigen ...
-
bioRxiv - Microbiology 2023Quote: ... A polymerase chain reaction (PCR) amplification using OneTaq Master Mix (NEB, M0482) was performed on C ...
-
bioRxiv - Biophysics 2022Quote: SNAP-tag labeling of SNAP-mGluR2 was done by incubating cells with 2 µM of SNAP-Surface Alexa Fluor 549 (NEB) and 2 µM of SNAP-Surface Alexa Fluor 647 (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... cells were labeled for 30 min at 37° C with 1 µM Surface BG-Alexa546 (impermeable dye; New England Biolabs) for SNAP in extracellular buffer (EX ...
-
bioRxiv - Pathology 2020Quote: ... Heat mediated antigen retrieval pretreatment using 10mM Sodium Citrate buffer (Vectors Biolabs) was used ...
-
bioRxiv - Immunology 2022Quote: ... 5 mol% labelled with SNAP-Surface Alexa Fluor 488 (NEB, S9128S), to 25% v/v HeLa lysate in a final volume of 20 µl (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: ... and CLIP-tag ligands (CLIP surface 647 - BC 647 [NEB, S9234S]) at final concentrations of 1 μM in 0.3% PBT ...
-
bioRxiv - Biochemistry 2023Quote: ... and SNAP-Surface® Alexa Fluor® 647 (New England Biolabs). Protein (5 µM ...
-
bioRxiv - Synthetic Biology 2020Quote: ... BG-fluorescein or BG-biotin conjugates (known as “SNAP-Surface® 649”, “SNAP-Cell® Fluorescein” and “SNAP-Biotin” respectively, NEB, at a 1:500 dilution ...
-
bioRxiv - Microbiology 2020Quote: Polymerase chain reaction (PCR) was performed using Q5 DNA polymerase (New England Biolabs). For cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Cell Biology 2022Quote: ... INS-1 832/3 SNAP- GLP- 1R or SNAP-GIPR cells were labelled in suspension with 40 nM SNAP- Lumi4- Tb and 1 mM SNAP- Surface 649 (New England Biolabs, Hitchin, UK) for 1 hr at room temperature in complete medium ...
-
bioRxiv - Molecular Biology 2019Quote: ... Heat mediated antigen retrieval pretreatment using 10 mM Sodium Citrate buffer (Vectors Biolabs) were used ...
-
bioRxiv - Biophysics 2020Quote: ... The fluorescent probe SNAP-Surface Alexa Fluor 546 (#S9132S) was from NEB Biotech ...
-
bioRxiv - Cell Biology 2019Quote: ... Shi-SNAP was labeled fluorescently with SNAP-Surface 488 (New England Biolabs), and Shi-SNAP-Surface 488-mediated actin bundles were visualized by TIRF imaging ...
-
bioRxiv - Cell Biology 2020Quote: ... and then labeled with SNAP-surface-549 (New England Biolabs, Ipswich, MA) overnight at 4°C following the manufacturers’ protocols ...
-
bioRxiv - Biochemistry 2020Quote: ... by SDS-PAGE after labeling with SNAP-Surface 549 (New England Biolabs). The strains had doubling times similar to their parental strains YF702 or YF4 (Fig ...
-
bioRxiv - Biophysics 2024Quote: ... SNAP-Surface Alexa Fluor 647 (catalog no. S9136S) was obtained from NEB. 40 nm and 90 nm diameter gold nanoparticles (catalog no ...
-
bioRxiv - Microbiology 2024Quote: ... beads were incubated with 10 μM SNAP-Surface Alexa Fluor 488 (NEB) for 1 hour at 4°C prior to elution ...
-
bioRxiv - Immunology 2021Quote: ... gBlocks were amplified by polymerase chain reaction (PCR) using Q5 polymerase (New England BioLabs) following the manufacturer’s protocol ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: The Cry2(1-531) gene was amplified by polymerase chain reaction (NEB Q5 polymerase) from the full length Cryptochrome-2 gene using a forward primer encoding an XhoI-restriction site with the sequence ...
-
bioRxiv - Genetics 2019Quote: ... the desired concentration for the PCR (Polymerase Chain Reaction) protocol (New England Biolabs Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Microbiology 2023Quote: ... used for Polymerase Chain Reaction (PCR) and Golden gate cloning kit (New England Biolabs) were carried out according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Polymerase Chain Reaction (PCR) was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed with Q5-HF polymerase (New England Biolabs, USA) or with CloneAmp Hifi polymerase (Takara Bio ...