Labshake search
Citations for New England Biolabs :
1851 - 1900 of 6947 citations for hsa mir 940 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: The pool of guide arrays was PCR amplified using NEBNext® High-Fidelity 2X PCR Master Mix (NEB) using 196 ng of starting template per 50 μl reaction using forward and reverse primers:
-
bioRxiv - Developmental Biology 2023Quote: ... and beads resuspended in a 50-µl PCR mix containing 1x NEBNext High-Fidelity PCR Master Mix (NEB) and 0.5 µM of Nextera Ad1_noMX and Ad2.X primers ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were undertaken using sporocarp extractions using the PHusion High-Fidelity PCR Master Mix (New England Biolabs). Libraries were generated using the TruSeq DNA PCR-Free Prep Kit (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed for 12 cycles using NEBnext High-Fidelity 2X PCR Master Mix (New England Biolabs, M0541L) (41) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and PCR products were purified with Monarch PCR and DNA Cleanup kit (New England Biolabs, Ipswich, Massachusetts, USA).
-
bioRxiv - Zoology 2024Quote: ... PCR products were purified with a Monarch PCR & DNA clean-up kit (New England Biolabs, Whitby, ON, Canada) and used as template to reamplify the products to incorporate a Kozak translation initiation sequence prior to the start codon (Kozak ...
-
bioRxiv - Molecular Biology 2023Quote: ... three 25 μl PCR reactions were pooled and purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB), according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and amplified PCR fragments were purified by column purification using the Monarch PCR Cleanup Kit (New England Biolabs) following the manufacturer’s protocols.
-
bioRxiv - Microbiology 2024Quote: ... The PCR product of the selected deletion mutant was purified using Monarch PCR and DNA cleanup kit (NEB) and sent for sequencing at Eurofins Genomics LLC (Louisville ...
-
bioRxiv - Microbiology 2020Quote: ... Genes were amplified from the relevant gDNA using the primers given above and Phusion polymerase (New England Biolabs), following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... we appended Illumina flow cell adapters and unique indices using NEBNext Dual Index Primers (New England Biolabs, E7600) via 10 more cycles of PCR ...
-
bioRxiv - Microbiology 2019Quote: ... The libraries were indexed with NEBNext Multiplex Oligos kits for Illumina (96 Index Primers, New England Biolabs, USA). Size distribution for the libraries and their quality were assessed using a high-sensitivity DNA chip (Agilent Technologies) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and reverse transcribed into cDNA with the use of random primers and ProtoScript II Reverse Transcriptase (NEB M0368S). Two sets of primers for ATPα1 were designed and used in subsequent PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... Indexed single-cells were sorted into 5μl of Smart-Seq2 lysis buffer (2μM Oligo-dT30VN primer, 2mM dNTP mix (10mM each, NEB), 1:50 RNAse inhibitor (promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... the optimized EGFP sequence was amplified using primers EGFP-lib For and EGFP-Rev using Phusion – HF (NEB). The PCR product was purified using Nucleospin Gel and PCR cleanup kit (Macherey Nagel ...
-
bioRxiv - Immunology 2019Quote: ... The generated cDNA was used as template for amplification of the emact full transcript using the primer pair Emact_Dw x Emact_Up by high fidelity polymerase chain reaction (Phusion, NEB). Resulting amplicons were sub-cloned into the pDrive cloning vector (QIAGEN ...
-
bioRxiv - Microbiology 2019Quote: ... Primer sequences were as previously described.7 Samples were digested with 1 unit of BamHI-HF enzyme (NEB) prior to running the PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... The rplD gene was amplified from Sinorhizobium meliloti Sm1021 genomic DNA using rplD_pSRK_GA_F and rplD_pSRK_GA_R primers and cloned into the pSRK (Kan) broad host range vector34 following the Gibson assembly protocol (NEB). Two mutant variants of the rplD gene were obtained through PCR-based site-specific mutagenesis with primer pairs rplD_G68H_F/rplD_mut_R and rplD_G68H+K65A_F/rplD_G68H+K65A_R and cloned into the pSRK plasmid as well ...
-
bioRxiv - Biochemistry 2021Quote: ... primers containing overhangs of the 3x FLAG peptide were phosphorylated using the T4 polynucleotide kinase (New England BioLabs). Phosphorylated primers were used to PCR amplify pQLinkN-pgaD to generate the plasmid pQLinkN-pgaD-FLAG ...
-
bioRxiv - Cell Biology 2021Quote: ... an NLS sequence was inserted downstream of the TagRFP sequence in the Cb expression vector described above with primers nls-insert_for and nls-insert_rev using the Q5 Site-Directed Mutagenesis Kit (NEB) and the resulting plasmid was used as a template to subsequently amplify the TagRFP-NLS sequence using the primers frag3-tRFP-nls_for and frag3-tRFP-nls_rev ...
-
bioRxiv - Plant Biology 2020Quote: ... were amplified from genomic DNA using primers in Supplemental Table 5 and Taq Phusion polymerase (New England BioLabs), cloned in pGEM-t Easy (Promega) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Systems Biology 2021Quote: ... The primers were designed to support HiFi DNA assembly (NEBuilder HiFi DNA Assembly Master Mix, New England BioLabs): dxs_thermus_F (5’-AAACCATGGAGGTGCGCGATATGATCTTGGACAAGGTGAAC-3’ ...
-
bioRxiv - Immunology 2021Quote: ... we modified the plasmid using primers EpMap_1 and EpMap_2 along with ssODN EpMap1_ssODN (Extended Data Table 3) using the NEBuilder Mastermix (NEB, E2621S) following the manufacturer’s instructions in order to create hairpin-free overlap regions that could be used for homology-based library cloning ...
-
bioRxiv - Microbiology 2020Quote: Amplification of adaptor-ligated DNA library was performed using barcoded primers and Phusion high-fidelity DNA polymerase (NEB) for 18 cycles according to provided instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... with additionally 1 μl oligo-dT primers and 1 μl of dNTP mix (NEB Biolabs, Ipswich, MA, USA). Further ...
-
bioRxiv - Cell Biology 2021Quote: ... with additionally 1 μl oligo-dT primers and 1 μl of dNTP mix (NEB Biolabs, Ipswich, MA, USA). Further ...
-
bioRxiv - Biophysics 2020Quote: ... ssM13mp18 at a concentration of 42 nM was mixed with 0.42 µM primer in NEBuffer 2.1(New England Biolabs). Samples were heated to 90°C for 30 seconds and cooled to 25°C at 0.1°C/sec ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used as template in a pre-amplification reaction by nested primers v2.1-F1 gagggcctatttcccatgattc and v2.1-R1 gttgcgaaaaagaacgttcacgg with 25 cycles and Q5 High-Fidelity DNA Polymerase (NEB), followed by unique barcoded primer combination for pool of all individual 50ul reactions for each genomic DNA sample ...
-
bioRxiv - Genetics 2022Quote: ... we PCR amplified NatMX from Addgene plasmid #35121 with the primers listed in Supplementary Table 6 using Phusion Hot Start Flex DNA polymerase (NEB). The NatMX cassette was transformed into the BY strain using the methods described above and transformants were plated onto YPD medium containing clonNAT ...
-
bioRxiv - Microbiology 2022Quote: ... The online NEBasechanger (https://nebasechanger.neb.com/) was used to design primers and the Q5 Site Directed Mutagenesis Kit (NEB) was used to generate pUPRTKO-ISC6pro-AC9ΔCC-3xTy (primers P13-14) ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Microbiology 2020Quote: ... 50 nM of each of the 27f and 534r primer mixes and 0.025U.μl−1 Taq DNA polymerase (NEB). The cycling parameters were 95 °C for 2 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... and barcoded using index primers from the NEBNext® Multiplex Oligos for Illumina® (New England BioLabs®) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... and barcoded using index primers from the NEBNext® Multiplex Oligos for Illumina® (New England BioLabs®). These libraries were processed using the MiSeq Reagent Kit v2 according to the manufacturer’s protocols and were sequenced in an Illumina MiSeq device in paired-end 2 × 150-bp mode.
-
bioRxiv - Molecular Biology 2019Quote: ... Non-overlapping forward and reverse primers containing the desired mutation were phosphorylated by polynucleotide kinase (New England Biolabs) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... A plasmid encoding T3D S1 in which a T249I mutation had been introduced into σ1 was engineered from the parental reverse genetics plasmid using ‘round the horn PCR (https://openwetware.org/wiki/%27Round-the-horn_site-directed_mutagenesis) with mutagenic primers (sequences available upon request) and Phusion High-Fidelity DNA Polymerase (New England Biolabs). Plasmids encoding rsT3DI segments with silent barcode mutations (Table 1 ...
-
bioRxiv - Genomics 2021Quote: ... The RNA samples were reverse transcribed using random hexamer primers and M-MuLV Reverse Transcriptase (New England Biolabs) and the resulting cDNA subjected to qPCR ...
-
bioRxiv - Biochemistry 2021Quote: ... 400 nM each of phosphorylated forward and reverse primers and 0.25 µL of Phusion Polymerase (2,000 U/mL) (NEB). PCR products were run on 1% agarose gels to confirm successful amplification ...
-
bioRxiv - Microbiology 2021Quote: ... SCBI genomic DNA with primers indicated in Supplementary Table S3 and using Q5 DNA Polymerase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... CREB (CCDS15005.1) and CRTC1 (CCDS40372.1) were amplified from mouse brain cDNA library by primers contain AgeI-HF (R3552L, NEB) and BamHI-HF (R3136L ...
-
bioRxiv - Cancer Biology 2021Quote: ... Poly(A)-cDNA was then amplified using an AL1 primer (ATTGGATCCAGGCCGCTCTGGACAAAATATGAATTCTTTTTTTTTTTTTTTTTTTTTTTT) and a blend of Taq polymerase (NEB) and Phusion (NEB).
-
bioRxiv - Immunology 2020Quote: ... before amplification with Illumina adapter-containing primers (Nextera i7 indices) and NEBNext Ultra II Q5 Master Mix (NEB) as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl of 100 μM SARS_139 and SARS_140 primers were mixed with 1 μl T4 Polynucleotide kinase (PNK; NEB) in 1x PNK reaction buffer (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... obtained with oligonucleotide primers listed in Table S4 and digested with the indicated restriction enzymes (New England Biolabs). Detection probes for phage DNA in Southern blots were generated by PCR using a non-proofreading polymerase (DreamTaq polymerase ...
-
bioRxiv - Cell Biology 2022Quote: ... we used three pairs of specific primers (Supplementary Table S2) with Q5 High Fidelity DNA Polymerase (NEB, M0491) or Phusion High Fidelity DNA Polymerase (Thermo Scientific Inc F530S) ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 ng of total RNA was mixed with 2 µL of random primer mix (New England Biolabs, UK) in RNase free PCR strips (Thermo Fisher ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were indexed with NEBNext Multiplex Oligos kit for Illumina (96 Index Primers, New England Biolabs, USA). Size distribution for the libraries and their quality were assessed using a high-sensitivity DNA chip (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... and the Tn7 transposon vector pEVS107 was linearized using primers RYI446 and RYI447 with Q5 DNA polymerase (NEB) (71) ...
-
bioRxiv - Microbiology 2023Quote: ... The gene of interest was amplified using primers described using either Q5 High-Fidelity DNA polymerase (NEB; M0491S) or Platinum Taq DNA polymerase High Fidelity (ThermoFisher Scientific ...