Labshake search
Citations for New England Biolabs :
1851 - 1900 of 3773 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... the pulL gene was PCR-amplified from plasmid pCHAP8258 as template using primers PulL Kpn 5 and PulL Eco 3 with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products were purified on a Qiaquick spin column ...
-
bioRxiv - Microbiology 2023Quote: ... The library preparation including an enrichment step for 5’-triphosphorylated RNAs by capping the RNAs with 3’-desthiobiotin-TEG-GTP (NEB) [15] and subsequent deep sequencing on a Illumina NextSeq 500 system with 75 bp read length were conducted at Vertis Biotechnologie (Germany ...
-
bioRxiv - Microbiology 2022Quote: ... The purified fragments were then 5’ phosphorylated in a 50 μL reaction containing 10 U of T4 polynucleotide kinase (NEB) and cleaned up through the Monarch PCR & DNA Cleanup spin columns (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA from the indicated cell lines was prepared in agarose plugs by resuspending 5 x 106 cells/ml in 0.8% agarose and digested overnight with Fse1 (NEB; R0588L) at 37 °C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... while the pML104-PDR1 vector has a guide sequence 5’- CTGGATAAACGTCGCTCCAC-3’ introduced by Q5 polymerase PCR (New England Biolabs) and In-Fusion Snap Assembly (Takara ...
-
bioRxiv - Cell Biology 2023Quote: ... Donor sequences were then inserted at the HindIII (5’) and XhoI or BamHI at (3’) sites using HindIII-HF and XhoI-HF or BamHI-HF (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3′ RNA adaptor (/5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Systems Biology 2023Quote: ... The glutathione or amylose agarose was then washed 5-10 times to remove unbound proteins before boiling and analysis by SDS-PAGE WB using anti-MBP (NEB) and anti-GST (abcam ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis of csn-5(D152N) was performed using a Q5 site-directed mutagenesis kit per manufacturer instructions (New England BioLabs). For transgenic lines used in PLA ...
-
bioRxiv - Biochemistry 2023Quote: ... The polyadenylated tail was added by incubation with 5 U of poly-A polymerase (New England Biolabs Inc., Massachusetts, USA) for 30 min at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... the 5’ end of each oligonucleotide to be ligated was phosphorylated using T4 Polynucleotide Kinase (T4PNK) (New England Biolabs: M0201) at 1 U/25 pmol ends incubated at 37 °C for 90 minutes followed by a 65 °C heat shock for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... and the samples were resuspended in cold Nuclei suspension buffer (5 mL PBS, 50 μL NEB BSA (10 mg/mL), and 25 μL RNase inhibitor (40 U/μL)) ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Cell Biology 2022Quote: ... All hybrid constructs were tested for expression and cloned into the pcDNA5/FRT/TO-N-FLAG-hBirA* using restriction enzymes: 5’ KpnI (NEB) and 3’ NotI (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ChIP-seq libraries were prepared using 2-5 ng of input and ChIP samples and the kit NEBNext Ultra DNA Library Prep for Illumina (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Genomics 2023Quote: ... Cells were then spun down at 500 g for 5 minutes and washed with 900 μL of NEBuffer 2.1 (New England Biolabs #B7202). The cells were pelleted (500 g for 5 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... The DNA was digested overnight at 37°C with gentle agitation after adding 25 µl of 10x NEBuffer3 and 5 ul of 25 U/ul MboI (NEB). To biotin end-fill the DNA a 50 ul master mix containing the following was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was ligated to the 5’ adaptor from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adaptor-ligated RNA was reverse-transcribed by SuperScript II and amplified by KAPA polymerase using the same primers as for the RNA sequencing.
-
bioRxiv - Biochemistry 2023Quote: Both native and modified oligonucleotides were 5’-32P labeled by [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs) following manufactures recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... The array DNA was composed of a fluorescent nucleotide Alexa Fluor 647-aha-dCTP (ThermoScientific) and was generated using Klenow Fragment 3’ – 5’ exo- (NEB). Nucleosome arrays were mixed with SUV420H1 or 5μM HP1α and incubated at room temperature for 20 mins before transferring to a glass bottom 384 well plate for imaging ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified the library using PCR with a 10 µl reaction mixture containing 5 µl of Phusion High Fidelity MASTER Mix (New England Biolabs), 2 µl of P1 primer (AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC G) ...
-
bioRxiv - Biophysics 2023Quote: Oligonucleotides used as substrates in D-loop assays were radiolabelled at their 5′-end using T4 Polynucleotide Kinase (T4 PNK - NEB) and adenosine triphosphate [γ-32P] (Perkin Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... media in each well was aspirated and cells were incubated in 80 μL of 1x Hanks’ balanced Salt Solution with 20 mM HEPES and 10 μL 100 μM Coelenterazine-400a diluted in PBS for 5 minutes before adding either 10 μL of 5.5 U of Enterokinase (New England Biolabs #P8070S) in PBS or 10 μL of vehicle PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were harvested and lysed as described above and were run over 5 ml of Amylose affinity resin (New England Biolabs), washed with 100 ml of 20 mM sodium phosphate pH 7.2 ...
-
bioRxiv - Cell Biology 2023Quote: MBP-tagged RH domain was isolated via passing cleared lysate over a gravity amylose resin column containing 5 mL of settled resin (NEB). Column was washed with 150 mL of buffer before eluting protein with wash buffer supplemented with 20 mM maltose ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Subsequently ...
-
bioRxiv - Physiology 2023Quote: ... purified and analyzed to quantify 5-methylcytosine levels by applying the DNA Purification Kit (T3010S, Monarch, New England Biolabs, USA) and the 5mC Assay Kit (lot no ...
-
bioRxiv - Bioengineering 2023Quote: ... for the ligation rounds are added to 96 well plates and their 5’ ends phosphorylated with T4 Polynucleotide Kinase (NEB). After 5’ phosphorylation ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Molecular Biology 2023Quote: ... and material was amplified for 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs catalog # M0541L). After evaluation by real-time PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of 5’ adapter (10 µM) was added and incubated for 5 min at 65°C before addition of T4 ligase buffer (NEB), final 25% PEG8000 and T4 RNA ligase 1 (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of the library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Then ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Table S6 ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Genomics 2023Quote: ... 5′-Tru-Seq small RNA adapters were ligated on to the de-capped RNA with T4 RNA Ligase 1 (NEB) in the presence of ATP and cDNA synthesized following Illumina small RNA-seq protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation and dA-tailing by NEBNext FFPE DNA Repair and NEBNext Ultra II End prep modules (New England Biolabs) and purified with AMPure XP (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: ... The radioactive probe was prepared from 40 pmoles of primers described in Supplementary Table 7 and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ- 32P]-ATP (150 µCi) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Bioengineering 2023Quote: ... The error-prone PCR (with an error rate of 3- to 5-nucleotide mutations per kilobase) was carried out with the Taq DNA polymerase (New England BioLabs) in a reaction containing 2 µl of 10 mM primers ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 μL of ligation reaction mix was prepared (1X ligation buffer, 5 units of T4 RNA ligase I (New England Biolabs), 0.5 μL RNaseOut Ribonuclease inhibitor ...
-
bioRxiv - Genomics 2024Quote: ... 120 µL 10x T4 DNA ligase buffer and 5 µL of 400 U/µL T4 DNA ligase (New England Biolabs) was added ...
-
bioRxiv - Genetics 2024Quote: The ligation reaction was performed in a 1:5 plasmid to insert copy number ratio using T4 DNA ligase (NEB) at 16°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... according to manufacturer’s instructions using 100 nM RNA-specific reverse transcription primer followed by RNase H digest with 5 µL RNase H (NEB) at 37 °C for 20 min ...