Labshake search
Citations for New England Biolabs :
1751 - 1800 of 3773 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: RNA samples from 2 differentiation time courses with 5 time points were used to synthesize full-length barcoded cDNA libraries using the Template Switching RT Enzyme Mix (NEB). Libraries were prepared using Pacific Biosciences protocol for cDNA Sequence Capture Using IDT xGen® Lockdown® probes (https://eu.idtdna.com/site/order/ngs) ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Microbiology 2022Quote: ... single-stranded adaptors (5’-Phos – ATCCACAACAACTCTCCTCCTC – 3’) were linked to the AdSDV genome segments using T4 RNA ligase I (New England Biolabs). Using the reverse adaptor primer paired with another primer ...
-
bioRxiv - Systems Biology 2019Quote: ... followed by the addition of a single dA overhang and ligation of the first adaptor (5′-phosphorylated) using dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs) ...
-
bioRxiv - Systems Biology 2019Quote: ... using the same method as the LC-MS/MS method described below for Dimroth rearrangement analysis following hydrolysis into nucleosides by RNA 5’ pyrophosphohydrolase (RppH, NEB) and shrimp alkaline phosphatase (SAP ...
-
bioRxiv - Microbiology 2019Quote: ... Individual fragments were designed that possessed 5’ and/or 3’ sequence homology to one another using Q5 high-fidelity DNA polymerase (New England Biolabs), followed by stitching the individual fragments together in a SOE reaction.
-
bioRxiv - Biochemistry 2019Quote: ... 10 pmol of oligonucleotide was labeled at the 5’ terminus with 0.05 mCi [γ-32P]-ATP using T4 Polynucleotide Kinase (New England Biolabs). For annealing ...
-
bioRxiv - Cell Biology 2019Quote: ... the M2×24 array was cloned into the pUBC-HaloTag-bActinCDS-bActinUTR-MS2V5 using 20 bp of 5’ and 3’ homology to replace the MS2 cassette using the Hifi builder enzyme mix (NEB). This was later followed by further Gibson assembly of the Halo-bActinCDS-bActinUTR-M2×24 insert into the pLenti-puro backbone using NEB Hifi builder ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’ RNA linkers with four terminal random nucleotides were then ligated to the small RNAs using T4 RNA ligase (NEB) followed by an SPRI magnetic bead purification (in-house-produced beads similar to Agencourt RNAclean XP) ...
-
bioRxiv - Biochemistry 2019Quote: ... encoding the reverse complement of the Illumina Read1 primer binding site (R1R) using Thermostable 5’ AppDNA/RNA Ligase (New England Biolabs). Ligated cDNAs were re-purified with MinElute Reaction Cleanup Kit and amplified by PCR for 12 cycles using Phusion DNA polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... the RNA was mixed with 10 µM of custom 5’ adapter and the ligation reaction was done using T4 RNA ligase 1 (M0437M, NEW ENGLAND BIOLABS) and with RNasin Plus ...
-
bioRxiv - Genomics 2019Quote: ... Illumina forked adaptors were added (final concentration 0.4 μM) and incubated with 80 μl quick ligase buffer and 5 μl of Quick Ligase (NEB M2200S) for 20 min at 25°C ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA bound to Gag was first dephosphorylated at the 5’ end with calf intestinal alkaline phosphatase (New England BioLabs, NEB) followed by T4 polynucleotide kinase-catalyzed (NEB ...
-
bioRxiv - Genetics 2020Quote: ... and wobble mutations to make constructs resistant to shOTUD5#5 were introduced in this vector using the Q5 site-directed mutagenesis kit (E0554, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... The remaining 22.5 μL aliquots of product were each digested for an hour at 37C with 0.6 μL of DpnI (NEB, R0176S). After digestion ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-5 uL of the cDNA product was PCRed with Phusion Hot Start Flex DNA Polymerase (New England BioLabs, M0535S), using a barcoded version of SGR-176 and a version of the 10x Genomics cDNA primer that included a P5 addition ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA fragments were purified from the reaction using a Zymo DNA Clean & Concentrator-5 kit (in-house) and amplified with NEBNext High Fidelity PCR Mix (NEB). Library quality was assessed using a Fragment Analyzer system (Agilent) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The sgRNA was constructed by annealing sense and anti-sense single stranded oligonucleotides containing 5’ Bsa1 restriction overhangs and was inserted into Bsa1 linearized pDR274 with the Quick Ligase Kit (NEB) (Table 1) ...
-
bioRxiv - Systems Biology 2020Quote: Digested DNA was heated to 50° C for 5 minutes to melt paired sticky ends then put into a 200 μL Klenow fragment (exo-, NEB) fill-in reaction containing 36 μM biotin-14-dCTP (Thermo Fisher ...
-
Suppressing STAT3 activity protects the endothelial barrier from VEGF-mediated vascular permeabilitybioRxiv - Molecular Biology 2020Quote: ... to a final concentration of 0.1µg/ml was incubated with 3 µg purified STAT3 proteins as well as 5 µl ATP (New England Biolabs; N0440S) for 30 minutes at 30°C ...
-
bioRxiv - Systems Biology 2019Quote: ... the sRNA gene of interest was cloned at the transcriptional +1 site under Para control by amplifying the pBAD+1 plasmid (Supplementary Table 5) by inverse PCR using Q5 DNA Polymerase (NEB). The pBAD+1 template is derived from pBADmycHisA (Tree et al. ...
-
bioRxiv - Genomics 2020Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends using Klenow fragment (3’ to 5’ exo minus, New England Biolabs). Precipitated DNA was incubated with adaptors at room temperature for 1 hr with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends using Klenow fragment (3’ to 5’ exo minus, New England Biolabs). Precipitated DNA was incubated with adaptors at room temperature for 1 h with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... epicentre cat # ER0720 or ER81050-we used this one) and A-tailing (100mM dATP; bioPioneer inc, Klenow; (3’-5’ exo- NEB) # M0212L (1,000 units ...
-
bioRxiv - Molecular Biology 2020Quote: ... put on ice for 5 min and the following components were added in the specified order: 1x capping buffer (NEB), 0.5 mM GTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ ends of ds-probes were radioactively labelled with [ψ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs), purified on Illustra Microspin G-25 columns (GE) ...
-
bioRxiv - Microbiology 2019Quote: ... and YO-3009 (5’-ggg ccc acc ggt CGC CAG AAT GCG TTC GCA CAG CCG CCA GC-3’) and Q5 polymerase (NEB), then cloned into the SacI and AgeI sites of pSL1180/S17DN ...
-
bioRxiv - Biochemistry 2021Quote: ... primers used are listed in Supplementary Table 5 and PCR was performed by standard procedures using Phusion high fidelity DNA polymerase (NEB). Gene deletion of sll1951 was performed by amplifying an upstream 966bp fragment in the N-terminal region of sll1951 using primers Sll1951leftfor and Sll1951leftrev and a 954bp downstream fragment in the N-terminal region of sll1951 using primers Sll1951rightfor and Sll1951rightrev ...
-
bioRxiv - Biochemistry 2021Quote: ... The insert is fused during cloning through an overlapping proline-encoding CCG codon introduced by reverse and forward primers at the 3’- and 5’-end of the sybodies and MBP respectively and released by digestion with the Type IIS restriction enzyme SapI (NEB). The second proline of the linker is encoded in the forward primer of the MBP (3’ of the overlapping CCG codon ...
-
bioRxiv - Genetics 2019Quote: ... around 300 nanogram of total RNA from each sample was first treated with RNA 5’ Pyrophosphohydrolase (New England Biolabs, MA) at 37°C for 30 minutes ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was instead PCR amplified from pGADCg using forward primer AP36 and reverse primer AP38 (5’ GCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGcatctattgaagtaat aataggcgcatg 3’) and cloned into NotI- and XmaI-digested (NEB) pDest-AD-QZ213 via homologous recombination in yeast ...
-
bioRxiv - Genomics 2021Quote: ... a 5’ adenylated DNA oligonucleotide containing the complement of an Illumina Read 1 sequencing primer-binding site was then ligated to the 3’ cDNA end with Thermostable 5’ AppDNA / RNA Ligase (New England Biolabs). Properly ligated cDNAs were amplified by PCR (12 cycles ...
-
bioRxiv - Genomics 2021Quote: ... “Fuorf_RNA_adapter” was ligated to the 3’ end of 10 μl of cDNA in a 20 μl reaction at 65 °C for 1 hour using Thermostable 5’ App DNA/RNA ligase (New England Biolabs). The reaction was inactivated at 95 °C for 3 minutes and 2 μl of the reaction was used as a template for PCR for sequencing library generation as described below.
-
bioRxiv - Genetics 2021Quote: ... 5’TTGGNNN…NNNGTTTAAGAGC3’and Oligo R: 5’TTAGCTCTTAAACNNN…NNNCCAACAAG3’) and ligating them together with the linearized vector using the T4 DNA ligase enzyme (NEB).
-
bioRxiv - Genetics 2021Quote: ... and Gibson-assembled in a final volume of 5 µl using NEBuilder HiFi DNA assembly master mix (NEB, Ipswich, MA), according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... A K13 propeller domain-specific guide gRNA was introduced into this vector at the BbsI restriction sites using the oligo pair p1+p2 (Supplementary file 5) using T4 DNA ligase (New England BioLabs). Oligos were phosphorylated and annealed prior to cloning ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Flanking primers contain 20 bp of 5’ and 3’ overlap with the pcDNA3.1 vector for Gibson Assembly (New England Biolabs, #E5510). The resulting library had an estimated complexity of 322 = 1024 codon variants and 202 = 400 amino acid variants ...
-
bioRxiv - Genomics 2020Quote: ... The pbp2x 5’-end and 3’-end amplicons were spliced with the linearized pBBL740 amplicon using NEBuilder HiFi kit (New England Biolabs). The resultant spliced plasmid was transformed into parental strain MGAS27213-L601P and single cross-over transformants were selected by plating on THY agar with chloramphenicol 10ug/ml ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR reaction was simplified to include 5 μl NEB Q5 Hot Start High Fidelity Master Mix (New England Biolabs), 1μl of the LCO_mod primer ...
-
bioRxiv - Physiology 2021Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England BioLabs), with 12 cycles of library amplification ...
-
bioRxiv - Biochemistry 2021Quote: ... The tested interference substrates of either target strand (TS) or non-target strand (NTS) were 5′-radiolabeled with T4 PNK (NEB) in the presence of gamma 32P-ATP ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was then supplemented with 5 mM DTT and the same concentrations of T4 polynucleotide kinase (New England BioLabs) and [γ-32P]-ATP (PerkinElmer ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA (50 pmol) was radiolabelled at 5′ end with by using 10 units of T4 polynucleotide kinase (New England Biolabs) mixed to 3 μl of γ32P-ATP (3000 Ci/mmol 10 mCi/ml ...
-
bioRxiv - Developmental Biology 2021Quote: ... Biotin removal from unligated fragments was performed by incubating DNA samples for 4h at 20C in a mix of 5 mL of 10X NEB2 buffer (New England Biolabs), 5 mL of a 1mM dNTPs mix ...
-
bioRxiv - Biochemistry 2021Quote: ... and plasmid IRES sequence (IRES_rev) using 5% of the genomic DNA as a template and Q5 polymerase (New England Biolabs - NEB) at 100 μL scale ...
-
bioRxiv - Genetics 2021Quote: ... An AMA1 replication vector backbone (pFCBB) of 10,129 bases was obtained from pFC332 (5) by restriction digest using PacI and BamHI-HF® (NEB), excising part of the Nt.BbvCI –PacI cloning site ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesised with SMARTNNN oligos were treated with 1 μl of Uracil DNA glycosylase (5 U/μl, New England Biolabs) and incubated for 15 minutes at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Gel extracted DNA fragments were incubated in a ratio of 1:3 of plasmid to insert (1:5 for inserts smaller than 300 nucleotides) in the presence of Gibson Assembly master mix (NEB) at 50°C for 1 hour.