Labshake search
Citations for New England Biolabs :
1801 - 1850 of 3967 citations for 5 Pyrimidinecarbonitrile 4 6 diamino 2 methoxy 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Control samples containing only RNA were treated with RNA 5’ Pyrophosphohydrolase (RppH, NEB, M0356S) to convert 5’-PPP RNA into 5’-P RNA ...
-
bioRxiv - Microbiology 2021Quote: ... dsRNA ladders and a 5’ Fluorescein-labeled RNA (300 nt) were provided by NEB and used as substrates for RNase I and RNase III activity assays ...
-
bioRxiv - Cell Biology 2021Quote: ... dynein-coated beads were labeled with 5 μM SNAP-Cell-TMR (New England Biolabs) in the column for 10 min at room temperature and unbound dye was removed with a 300 mL wash with TEV buffer at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformations were performed using NEB 5-alpha chemically competent cells (New England BioLabs). E ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ RACE products were generated with Template Switching RT Enzyme Mix (New England Biolabs) using anchored poly(dT)23 and TSO (GCT AAT CAT TGC AAG CAG TGG TAT CAA CGC AGA GTA CAT rGrGrG ...
-
bioRxiv - Molecular Biology 2021Quote: ... in the presence of 5 U of Quick-CIP alkaline phosphatase (New England Biolabs). After dialysis ...
-
bioRxiv - Genomics 2022Quote: ... Dangling ends were removed by a 5 min incubation with Exonuclease III (NEB #0206) at 37 °C and biotin enrichment was done using 20 ul Dynabeads™ MyOne™ Streptavidin C1 beads (Invitrogen #65001) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The linkers that were pre-adenylated using a 5’ DNA adenylation mix (NEB, #E2610L) were ligated to dephosphorylated RNAs using T4 truncated RNA ligase 2 (K227Q ...
-
bioRxiv - Genomics 2022Quote: ... the end-repaired DNA was mixed with Klenow Fragment (3′ → 5′ exo−) (NEB, #E6044A) in NEBNext dA-Tailing Reaction Buffer (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 5 µl of collection buffer (NEBNext Single Cell Lysis Module, New England Biolabs). Noteworthy ...
-
bioRxiv - Genomics 2023Quote: ... around 5 million cross-linked nuclei were digested overnight using 400 U DpnII (NEB). After digestion ...
-
bioRxiv - Genomics 2023Quote: ... 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs, E6111L), and 0.25 uL of mRNA Second Strand Synthesis enzyme (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... 5 μl of genomic DNA was used with Luna Universal qPCR Master Mix (NEB) and primers for the R ...
-
bioRxiv - Genomics 2023Quote: ... The DNA/RNA hybrid strand was pre-adenylated with DNA 5’ Adenylation Kit (NEB) and purified with Oligo Clean & Concentrator (Zymo) ...
-
bioRxiv - Cancer Biology 2023Quote: ... A volume of 40 μl reaction mix containing 5 μl isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Genetics 2023Quote: ... 5% DMSO and 1× NEBNext High-Fidelity PCR master mix (New England BioLabs, M0541L) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Injection mixtures contained 10μl restriction digest including 5 units of I-SceI enzyme (NEB), 1μl CutSmart buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µg of genomic DNA from the clones were digested solely with XhoI (NEB) overnight at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... cleaned and concentrated 20x using the Monarch PCR & DNA Cleanup Kit (5 µg) (NEB). Further cleanup was done with the E-gel imager system (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... which was purified directly over Monarch DNA Cleanup Columns (5 μg) (New England Biolabs) using a 10:1 ratio of binding buffer (a modified version of Qiagen’s PB buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then 3’-end dephosphorylated and 5’-end phosphorylated using T4 polynucleotide kinase (NEB). tRNA library preparation used SuperScript™ IV following the QuantM-tRNA-seq protocol (Pinkard et al ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs, E6111L), and 0.25 uL of mRNA Second Strand Synthesis enzyme (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... The 5′ UTR and coding sequence were amplified in Q5 polymerase reactions (NEB, M0491) with 10 ng HsCD00617865 template and 500 nM forward and reverse primers for 25 cycles using manufacturer’s recommendations with 55 °C annealing temperature ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... stained in HI buffer containing 5 μM SNAP-Surface Alexa 647 (New England Biolabs) for 15 minutes at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... RNAs were 5’dephosporylated through 90 minutes incubation in total with thermostable QuickCIP (NEB) in which the samples were briefly heated to 75°C and quickly chilled on ice at the 60 minutes mark ...
-
bioRxiv - Immunology 2023Quote: ... 5 µg of sequencing verified plasmid were restriction digested using BsmBI V2 (NEB, #R0739S) in a 50 µl reaction with NEB3.1 buffer (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... 5% (v/v) DMSO and 0.5 U Phusion High-Fidelity DNA polymerase (NEB, M0530S). Cycling was performed using the following thermocycler settings ...
-
bioRxiv - Genetics 2023Quote: ... along with an additional 5 µL 2x Gibson Assembly Master Mix (NEB Cat#E2611L). The reaction mixture was incubated at 50°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... All the produced constructs were propagated in competent cells (5-alpha Competent E.coli; NEB) and isolated by NucleoSpin Plasmid (TaKaRa) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Dephosphorylation of DNA ends was performed by addition of 5 μl rSAP (NEB, #M0203) and incubation at 37°C for 45 min ...
-
bioRxiv - Pathology 2024Quote: ... 5 min ice) and plasmids were extracted using the Monarch Plasmid Miniprep kit (NEB) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... DNase-treated total RNA was further treated with RNA 5’ Pyrophosphohydrolase (New England Biolabs) to remove possible pyrophosphate from the 5’ end ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5′ end labelled using γ32P UTP (Perking Elmer) and T4 polynucleotide kinase (NEB) following manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... Ligation products were transformed into either 5-alpha or 10-beta electrocompetent cells (NEB) and grown in liquid LB-Amp cultures ...
-
bioRxiv - Bioengineering 2024Quote: The 5’ RACE protocol using the template-switching reverse transcriptase enzyme mix from NEB was executed following the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2024Quote: ... The myc epitope was added before the stop codon of blaSHV-5 by NEB Q5 Site-Directed Mutagenesis according to the manufacturer using primers JCP505/506 with pTOX5 blaSHV-5 template ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Pathology 2019Quote: ... 1 μL (2 units) DNAse I (M0303S, New England BioLabs, Ipswich, MA), and 89 μL nuclease-free H2O ...
-
bioRxiv - Genomics 2019Quote: ... For that the mix containing 2 µL of RNAse H (NEB, #M0297S), 1 µL of E ...
-
bioRxiv - Biochemistry 2019Quote: ... 400ng of library was amplified for 2 rounds using standard Phusion (NEB) PCR conditions ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was then passed over a 2 mL amylose column (NEB) and washed with 3 CV of Flag Wash Buffer ...