Labshake search
Citations for New England Biolabs :
1901 - 1950 of 3967 citations for 5 Pyrimidinecarbonitrile 4 6 diamino 2 methoxy 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 2.5 μL 10 mM MnCl2 and 2 μL Lambda Protein Phosphatase (NEB). The dephosphorylation reaction was allowed to occur at 30 °C overnight ...
-
bioRxiv - Immunology 2023Quote: ... 2 μL of T4 RNA Ligase (10 000 U/mL, NEB, M0204S), and 10 μL of PEG 8000 50% (NEB ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... gDNA (1.2 μg) was treated with 2 U RNase H (NEB, M2097) per µg of gDNA for 4 h at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... A mastermix containing 2 mmol/L of each dNTP (NEB, Ipswich, MA), 4.5 µg of random hexamers (ThermoFisher ...
-
bioRxiv - Biochemistry 2024Quote: ... RNA was ligated using T4 RNA ligase 2 (M0242, New England Biolabs) to a preadenylated linker and purified with ROTI Aqua P/C/I for RNA extraction and precipitated with NaOAc ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nucleosomes labeling the following reaction was used: NEBuffer™ 2 (NEB B7202), inhibitors (as detailed above ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... The entire alh-6 genomic sequence (ATG to stop) was amplified by PCR and cloned in a linearized pMiniT 2.0 vector (NEB PCR Cloning Kit, Cat. #E1202S). Plasmid DNA was purified using the Zymo Research Zyppy Plasmid Miniprep kit (Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S). After transformation into chemically-competent Top10 E ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated with 4 μM SNAP-Cell TMR-Star (New England Biolabs S9105) or SNAP-SiR647 (New England Biolabs S9102 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Immunology 2022Quote: ... Equal amount of total RNA in a maximal volume of 6 µ L is used for cDNA synthesis using NEB PhotoScript® First Strand cDNA Synthesis Kit (Catalog # E6300L, NEB Inc, Ipswitch, MA) as instructed in the manufacturer standard protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... RNase H treatment on fixed cells was performed using 5 U RNase H (M0297, NEB) for 3 h at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... with subsequent end repair/dA-tailing reaction using Klenow Fragment (3’-5’ exo-) (NEB M0212S) and ligation with Illumina sequencing adapters using T4 DNA ligase (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: 5-7 μg of HiC library in a total volume of 100 μl (1x NEB buffer 2.1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... a set of 5’-end biotinylated anti-sense DNA oligoes and 5ul RNase inhibitor (NEB) were added to the lysate ...
-
bioRxiv - Molecular Biology 2020Quote: ... oligonucleotides were 5-end labeled with 32P-γATP using T4 polynucleotide kinase (New England Biolabs). Supercoiled pUC19 plasmid dsDNA was prepared by a method that did not involve DNA denaturation (Clewell and Helinski ...
-
bioRxiv - Genomics 2020Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’UTR Nr4a1 mutant was made using Q5® Site-Directed Mutagenesis Kit (NEB BioLabs) according to the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’UTR Nr4a1 mutant was made using Q5® Site-Directed Mutagenesis Kit (NEB BioLabs) according to the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR reaction contained 0.5 μl of 5 U/μl Taq polymerase (New England Biolabs), 0.5 μl dNTPs (10 mM) ...
-
bioRxiv - Genomics 2019Quote: ... and 10 µL of 5 U/µL DNA Polymerase I Large (Klenow) Fragment (NEB, M0210). The reactions were then rotated at 37°C for 45 min ...
-
bioRxiv - Biophysics 2019Quote: ... using a 5-fold excess of fluorophore to protein and ∼1 μM Sfp synthase (NEB) for 16 hours at 6 °C in 50 mM TRIS-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μg DNA samples were digested with 10 u HindIII (New England Biolabs, Ipswich, MA) for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: 5’ RACE was performed using the Template Switching RT Enzyme Mix (New England Biolabs M0466) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2021Quote: Decapping of 5 µg total RNA was performed with 200 units of yDcpS (NEB M0463S) in 10mM Bis-Tris-HCl pH 6.5 ...
-
bioRxiv - Genomics 2021Quote: ... The ligation mix (5 μL of LNB, 3 μL of Quick ligase (New England Biolabs), 1.2 μL of MQ ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by addition of 3’-A overhangs using Klenow Fragment 3’-5’ exo- (NEB, M0212S). After denaturation of DNA at 95°C for 3 min ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA substrates were 5’ end labeled using γ32P-ATP and T4 Polynucleotide Kinase (NEB, MA)38 ...
-
bioRxiv - Pathology 2021Quote: ... The second strand was synthesized with Klenow Fragments (3′-5′ exo-; New England Biolabs Inc.) and complement chains of NSR primers ...