Labshake search
Citations for New England Biolabs :
1651 - 1700 of 3967 citations for 5 Pyrimidinecarbonitrile 4 6 diamino 2 methoxy 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... diluted to 2 mg/ml in Nuclease-Free Water (NEB, B1500L), at 37°C for 15 minutes each ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml Tris buffer ...
-
bioRxiv - Genetics 2023Quote: ... 5μL of 2× Luna Universal qPCR Master Mix (NEB, MA, USA). The amplification program was set as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μL of 10x DNase I Buffer (New England Biolabs, #m0303s), 1 μL of rDNase I (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... a hybridization reaction was carried out in 1X Buffer 2 (NEB). 10 µM pool of designed oligomers and 10 µM of a complementary-overlap-containing-oligomer were first denatured at 95°C for 15 seconds and allowed to hybridize at 43°C for 5min ...
-
bioRxiv - Genomics 2023Quote: ... 0.3 μg DNA was digested with 2 U DpnI (NEB R0176S) or 5 U MboI (NEB R0147S ...
-
bioRxiv - Genomics 2023Quote: ... 0.25 μM of adapter and 2 μL of Quick ligase (NEB) for 20 minutes at 23°C in 40 μL ...
-
bioRxiv - Cancer Biology 2023Quote: ... For nucleosomes labeling reaction mix contained: NEBuffer™ 2 (NEB B7202), protease and HDAC inhibitors (as detailed above) ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 µL NEBNext HiFi 2× PCR Master Mix (New England BioLabs) was added to the DNA mixture ...
-
bioRxiv - Molecular Biology 2023Quote: ... or RNase A (2 µg, Monarch RNase A; New England Biolabs) and incubating for another 15 min at 25°C ...
-
bioRxiv - Genomics 2024Quote: ... A-tailing was done with 1X NEBuffer 2 (New England Biolabs), 0.2 mM dATP ...
-
bioRxiv - Genomics 2024Quote: ... 20 µL of 2% BSA (New England Biolabs, catalog no. B9000S), and 1.86 mL of nuclease-free water ...
-
bioRxiv - Genomics 2024Quote: ... 2.5 μl of DTT and 2 μl of Blunting Enzyme (NEB) in a total reaction volume of 50 μl ...
-
bioRxiv - Genomics 2024Quote: ... the reaction is treated with 2 μl of Proteinase K (NEB). The digestion is carried on at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2024Quote: ... and 2 µg/µL of Proteinase K (New England Biolabs, #P8107S), was prepared and loaded into a 3 mL syringe (BD Biosciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were first incubated with Deglycosylation Mix Buffer 2 (NEB) at 75°C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM DTT) and a wash with 10 μL streptavidin (NEB). The chamber was further washed with 10 μL TIRF buffer followed by a 1-minute incubation with 2 μL of microtubules diluted in 8 μL TIRF buffer supplemented with 50 mM KCl and 1.25 mg/mL casein (TIRF-Casein) ...
-
bioRxiv - Cell Biology 2020Quote: 5′ end phosphorylation and radiolabeling (1x PNK buffer, 40 U T4 PNK (NEB), 40 μCi 32P-γATP ...
-
bioRxiv - Cell Biology 2020Quote: 5′ linker ligation (1x PNK buffer, 40 U T4 RNA ligase I (NEB), 80 U RNasIN ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 20 min at 37 °C and analyzed by 2% agarose gel electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... except that 5 uL of Phusion Hot Start Flex 2X Master Mix (NEB) was used ...
-
bioRxiv - Genomics 2019Quote: ... The mixture was supplemented with 5 µL DNA polymerase (3 U/µL, NEB) and 6 µL Klenow (5 U/µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Neuroscience 2019Quote: ... was first transformed into NEB 5-alpha competent cells (New England Biolabs #E2621S) and plated on LB plus ampicillin (60 µl/ml).
-
bioRxiv - Genetics 2019Quote: ... and then treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 30 min at 37°C and finally analyzed by 2% agarose gel electrophoresis.
-
bioRxiv - Immunology 2019Quote: ... followed by site-directed mutagenesis using the Q-5 kit (New England Biolabs) in order to generate point mutations into MIC1 (MIC1-T126A/T220A ...
-
bioRxiv - Molecular Biology 2021Quote: The 5’ RACE PCR product was digested using BamHI (New England Biolabs R0136) and EcoRV (New England Biolabs R3195 ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 μg were digested overnight at 37°C with FspEI (NEB, R0662S), which recognizes CMC sites and creates a double-stranded DNA break on the 3’ side of the modified cytosine at N12/N16 ...
-
bioRxiv - Genomics 2021Quote: ... 5’-ENGRAM 2.0 recorder was digested with Xbal and Ncol (NEB, CutSmart buffer) at 37°C for 1h and purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenylation of R1R was done using 5’ DNA Adenylation kit (New England Biolabs) according to manufacturer’s instructions and cleaned with Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were 5′-labeled with 32P-γ-ATP using T4 polynucleotide kinase (NEB) and purified on P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... RNA was phosphorylated on the 5’ end using T4 polynucleotide kinase (NEB, M0201L) then ligated onto a 5’ adapter ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Microbiology 2022Quote: ... golden-gate compatible template was created by 5’-phosphorylating with T4 PNK (NEB) and annealing of oligonucleotides ...
-
bioRxiv - Bioengineering 2022Quote: Escherichia coli (E. coli) strain NEB 5-α (New England Biolabs, Hertfordshire, UK) was used for generation of genetic constructs ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5’ ends were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, M0201L). Each gene-specific pool of 51mer oligonucleotides was mixed with a 20mer ligation adapter (ACAGTCACTTCAACACTCAG ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Molecular Biology 2019Quote: Synthesized guide RNAs were 5’-labeled with 32P using T4 PNK (NEB #M0201) and [γ-32P]ATP (Perkin Elmer #BLU002A250UC ...
-
bioRxiv - Genetics 2019Quote: ... and 5 U/µl DNA polymerase I Klenow (8 µl; New England Biolabs), and incubated for 90 min at 37°C with rotation ...
-
bioRxiv - Molecular Biology 2019Quote: ... Nucleotides were dephosphorylated by addition of 5 units of CIP (New England Biolabs) for another 2 hours at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction mixture was then incubated with 5 units of Antarctic Phosphatase (NEB) for 1 h at 22 °C to hydrolyze unreacted GTP ...
-
bioRxiv - Microbiology 2021Quote: ... Bound RNA was degraded with 5 units of RNase H (New England Biolabs) and the cDNA purified by ethanol precipitation overnight at −20 °C (3x volumes of ethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...