Labshake search
Citations for New England Biolabs :
1801 - 1850 of 4162 citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... homology arms were PCR amplified and cloned by a 4-fragment Gibson assembly (NEB E2621S) within the loxP-Blasticidin-HSVTK-loxP-TetOx96 and CuOx150-FRT-Neomycin-FRT plasmids73 ...
-
bioRxiv - Immunology 2024Quote: ... Purified RNA was treated with 4 units of DNase I (1µL/unit) (NEB, Cat. # M0303) for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Biophysics 2021Quote: ... Handle 2 was then digested with Lambda Exonuclease (M0262, New England BioLabs), which removes nucleotides from linearized double-stranded DNA in the 5′ to 3′ direction ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 186 bp DNA (0.4 mg/ mL) in 1x NEBuffer 2 (NEB: B7002) was incubated with dATP (100 μM) ...
-
bioRxiv - Biochemistry 2020Quote: ... was de-phosphorylated with 2 μL of Calf Intestinal Phosphatase (NEB M0290S) for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM of 7MeGpppA or GpppA RNA cap analogue (New England Biolabs), 10 μM adenosyl-methionine (AdoMet ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR amplifications were carried out using 2 x Q5 Master Mix (NEB), with cycling times and temperatures according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... and further passivated with 2 mg/ml Bovine serum albumin (BSA, NEB:B9000S) to prevent non-specific binding of proteins and DNA to the surface ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of total RNA was treated with DNase (New England Biolabs) and for the RT-qPCR experiment ...
-
bioRxiv - Genomics 2022Quote: ... followed by reverse-crosslinking with 2 ug/uL proteinase K (NEB, P8102), 1% SDS ...
-
Recurrent but short-lived duplications of centromeric proteins in holocentric Caenorhabditis speciesbioRxiv - Evolutionary Biology 2022Quote: ... RNA was treated with DNase I (New England Biolabs, 2 units/μl) at 37°C for 60 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... beads were resuspended in 50 μL of 1X NEBuffer 2 (NEB, B7002S) containing 0.1 mM dATP and 15 units of Klenow Fragment (3’→5’ exo- ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... We loaded genomic digests and 100ng of 2-log ladder (NEB N3200) onto a 1% agarose gel and subjected it to electrophoresis in 1XTTE overnight at 49V ...
-
bioRxiv - Immunology 2022Quote: ... a quantitative PCR reaction (10 µl 2 x PCR master mix (NEB), 1 x SYBR green (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... and cloning was performed using the Gibson Assembly 2× Master Mix (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and once with 2 bead volumes of 1X RNase H Buffer (NEB; 50mM Tris-HCl ...
-
bioRxiv - Genetics 2020Quote: ... using 2 μl of NEBNext dsDNA Fragmentase (New England Biolabs, cat. M0348), supplemented with 1 μl 200 mM MgCl2 ...
-
bioRxiv - Bioengineering 2020Quote: ... the SARS-CoV-2 RNA was obtained by in vitro transcription (NEB, HiScribe™ T7 High Yield RNA Synthesis Kit ...
-
bioRxiv - Developmental Biology 2021Quote: The DNA was then digested with 2 μL CutSmart Buffer (NEB, R0137L) and 1 μL Alul enzyme (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was rocked with 2 mL of amylose resin slurry (NEB) for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... To release N-glycans 2 μl of PNGase F (New England Biolabs) was added and the samples were incubated for 18 h in 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with equal volume of 2× RNA Loading Dye (New England Biolabs), heated at 90 °C for 2 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by 2 µL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μL of NEBNext FFPE DNA Repair Mix (New England Biolabs, UK), 3.5 μL Ultra II End-prep reaction buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 2 µL BsaI-HF v2 Golden Gate enzyme mixture (New England Biolabs), 4 µL 10× T4 Ligase buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 units/µl of murine RNase inhibitor (New England Biolabs, M0314L). In minigene experiments ...
-
bioRxiv - Developmental Biology 2023Quote: ... Digestion was performed with 2 µl (10U) of thermostable RNaseH (NEB #M0523S) and 2 µl of 10X buffer in a 20 µl volume at 65° C for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... and 2 µl CutSmart buffer (New England Biolabs, cat. no. B7204S, 10×) at 37°C for 2h ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Genetics 2022Quote: ... were ligated using a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... 1X NEB Buffer 2 and 0.20μg/μl BSA (all from NEB, USA) was added to the wells and incubated at 25°C for 1.5h ...
-
bioRxiv - Bioengineering 2024Quote: ... A mastermix containing 2 mmol/L of each dNTP (NEB, Ipswich, MA), 4.5 µg of random hexamers (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 DNA fragment plasmids were digested with I-SceI (NEB) to release the overlapping fragments from the backbones ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 37 °C for 2 hours followed by digestion with PspXI (NEB) in rCutsmart™ Buffer (NEB ...