Labshake search
Citations for New England Biolabs :
1951 - 2000 of 4162 citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 4 µg of each sample was reverse transcribed using dT priming with Protoscript II (NEB, M0368L) and subsequently treated with 0.5 µL each of Rnase H and Rnase A (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM UTP and 1 mM GTP and 4 mM ARCA (Anti-Reverse Cap Analog) (NEB)) ...
-
bioRxiv - Genetics 2024Quote: ... Plugs were then equilibrated in NEBuffer 4 and treated with 75 U of exonuclease T (NEB) for 90 min at 24 °C.
-
bioRxiv - Biochemistry 2024Quote: ... Alkaline phosphatase treatment was performed over night at 4°C using Lambda Protein Phosphatase (#P0753S, BioLabs).
-
bioRxiv - Cancer Biology 2021Quote: ... 2 μg DNA spiked with methylation standards was digested with SmaI endonuclease (NEB) at 25°C for 8 h ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... Q5-high Fidelity 2× master mix was used as polymerase from NEB (# M0429L). PCR condition for the 1st PCR was ...
-
bioRxiv - Developmental Biology 2021Quote: ... 200 ng of PCR products in 1X NEB buffer 2 (New England Biolabs) were hybridized under the following conditions ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...
-
bioRxiv - Developmental Biology 2022Quote: ... washed before either incubation with SNAP-Cell TMR-Star at 2 μM (NEB) and SNAP-Surface Block at 13 μM (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... following incubation for ∼2 hours of 10 mg/ml BSA (New England Biolabs) diluted in buffer A containing 20 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μL of 1× PNK mix (2 μL of 10× PNK buffer (NEB), 2 μL ATP (SCP801 ...
-
bioRxiv - Genomics 2022Quote: ... 1 or 2 μl of 1U/μl USER® II enzyme (M5505S, NEB) and nuclease-free water to made up to 10 μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2X hybridisation buffer (4X SSC, 20% dextran sulphate, 2 mg/mL BSA (NEB), 1/10 volume nuclease free water and 1/10 volume vanadyl-ribonucleoside complex (VRC ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sequencing libraries were prepared using NEBNext HiFi 2× PCR Master Mix (NEB, M0541L) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Dynein-dynactin-adaptor complexes were labelled with 2 µM SNAP-TMR dye (NEB) during the isolation procedure from rat brain lysate (McKenney et al. ...
-
bioRxiv - Systems Biology 2020Quote: ... 2 mL of ligation mix (500 μL of T4 Ligase Buffer 10x (NEB), 100 μL of T4 DNA Ligase (400 U/μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR round 1 and 2 were performed using Q5-High Fidelity polymerase (NEB) for 6 (FS231 and FS232 ...
-
bioRxiv - Cell Biology 2021Quote: ... and lysate was incubated 37°C 60 min in 2 units CIP (NEB) per 50 μL reaction containing 50μg of total protein ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 μg of total RNA was treated with DNase I (New England BioLabs) and then cleaned with RNA Clean and Concentrator-5 (Zymo Research) ...
-
bioRxiv - Biochemistry 2022Quote: ... and PCR library amplification (KAPA library amplification primers; NEB Ultra 2× master mix), followed by double-sided SPRI size selection and a final 0.9× SPRI purification ...
-
bioRxiv - Neuroscience 2022Quote: ... 25 μl NEBNext High-Fidelity 2× PCR Master Mix (New England Biolabs, M0541S), 9 μl of unique ...
-
bioRxiv - Plant Biology 2021Quote: ... This 2 kb fragment was subsequently cloned into the Eco53kI restriction enzyme (NEB) site of pK18B-E (Jayaraman et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2μl 10 mM dNTPs and 1μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Biophysics 2021Quote: ... following passivation for ~2 hours of 10 mg/ml BSA (New England Biolabs). After removing non-adhered BSA by washing the flow cell with PBS ...
-
bioRxiv - Microbiology 2020Quote: ... lot 0091412 and the NEBNext multiplex Oligos for Illumina (Set 2, NEB #E7500) lot 0071412 ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.6 and incubated overnight with 2 µl PNGase F (New England BioLabs) and 0.5 µl sialidase A (Prozyme) ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, #N0446), 10 μl 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were treated with 2 μl of proteinase K (NEB, 800 units/ml) for 20 min at 37 °C and 5 ul of each sample was applied onto 20% denaturing gels (20% acrylamide/bis-acrylamide ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µg of total RNA was treated with DNase I (New England BioLabs) and then cleaned with RNA Clean and Concentrator-5 (Zymo Research) ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 2□ μl of 1× NEB Next Cell Lysis Buffer (New England Biolabs). FACS sorting was performed with a BD Influx sorter (BD Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... and then digested with 2 μL Nucleoside Digestion Mix (#M0649, New England Biolabs) in a 50 μL reaction incubated at 37 °C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM CaCl2) at room temperature in the presence of recombinant enteropeptidase (NEB) at 13 U enzyme per mg TMPRSS2 zymogen ...
-
bioRxiv - Immunology 2020Quote: 2 μg of base expression vectors were digested using NotI-HF (NEB # R3189S) and SmaI (NEB # R0141S ...