Labshake search
Citations for New England Biolabs :
1701 - 1750 of 4162 citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of Endo H (New England Biolabs catalog number P0702L), were combined with H2O to reach a total volume of 10 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 μL Phusion® HS Flex polymerase (2 U/μL - NEB), in a final volume of 40 μL ...
-
bioRxiv - Microbiology 2024Quote: ... and was loaded onto 2 mL of chitin resin (NEB; #S6651S) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein was digested by adding 2 µL of PK (NEB) to the mixture and incubating at 45°C for 45 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µL of 10X RNase H Buffer (New England Biolabs, M0297S), and 1 µL of RNase H (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... 200 mM NaCl and 2 µl of proteinase K (NEB # P8107S) and incubated overnight at 65°C to lyse nuclei bound to the beads and DNA was extracted using phenol-chloroform and precipitated using glycogen ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl of 10x reaction buffer (New England Biolabs, Ipswich, MA), 2 µl 0.1M DTT ...
-
bioRxiv - Biochemistry 2024Quote: gDNA was digested for 2 h with BamHI and XmnI (NEB). Multiplex 24 μL ddPCR reactions were prepared by mixing 12 μL of ddPCR supermix (no dUTP ...
-
bioRxiv - Cancer Biology 2024Quote: ... Primers Set 1 and 2 (NEB, cat. no. E7335 and E7500). We proceeded by pulling the samples together ...
-
bioRxiv - Cell Biology 2020Quote: 5′ end phosphorylation and radiolabeling (1x PNK buffer, 40 U T4 PNK (NEB), 40 μCi 32P-γATP ...
-
bioRxiv - Cell Biology 2020Quote: 5′ linker ligation (1x PNK buffer, 40 U T4 RNA ligase I (NEB), 80 U RNasIN ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 20 min at 37 °C and analyzed by 2% agarose gel electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... except that 5 uL of Phusion Hot Start Flex 2X Master Mix (NEB) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Molecular Biology 2021Quote: The 5’ RACE PCR product was digested using BamHI (New England Biolabs R0136) and EcoRV (New England Biolabs R3195 ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 μg were digested overnight at 37°C with FspEI (NEB, R0662S), which recognizes CMC sites and creates a double-stranded DNA break on the 3’ side of the modified cytosine at N12/N16 ...
-
bioRxiv - Genomics 2021Quote: ... 5’-ENGRAM 2.0 recorder was digested with Xbal and Ncol (NEB, CutSmart buffer) at 37°C for 1h and purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenylation of R1R was done using 5’ DNA Adenylation kit (New England Biolabs) according to manufacturer’s instructions and cleaned with Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were 5′-labeled with 32P-γ-ATP using T4 polynucleotide kinase (NEB) and purified on P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... RNA was phosphorylated on the 5’ end using T4 polynucleotide kinase (NEB, M0201L) then ligated onto a 5’ adapter ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Microbiology 2022Quote: ... golden-gate compatible template was created by 5’-phosphorylating with T4 PNK (NEB) and annealing of oligonucleotides ...
-
bioRxiv - Bioengineering 2022Quote: Escherichia coli (E. coli) strain NEB 5-α (New England Biolabs, Hertfordshire, UK) was used for generation of genetic constructs ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5’ ends were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, M0201L). Each gene-specific pool of 51mer oligonucleotides was mixed with a 20mer ligation adapter (ACAGTCACTTCAACACTCAG ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction mixture was then incubated with 5 units of Antarctic Phosphatase (NEB) for 1 h at 22 °C to hydrolyze unreacted GTP ...
-
bioRxiv - Microbiology 2021Quote: ... Bound RNA was degraded with 5 units of RNase H (New England Biolabs) and the cDNA purified by ethanol precipitation overnight at −20 °C (3x volumes of ethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µl Reverse External Primer (10 µM) and Nuclease-free water (NEB,USA) up to 100 µl were mixed on ice ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μM of SNAP-surface549 or SNAP-surface649 (New England Biolabs; Ipswich, MA) was incubated with the beads rotating overnight at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... and purified with Monarch PCR & DNA Cleanup Kit (5 μg) (NEB, Ipswich, USA), checked on an 1 % (w/v ...
-
bioRxiv - Genomics 2020Quote: ... the genome was digested by 5 μl enzyme HaeIII (10 U/μl, NEB) with 81.5 μl H2O ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA 5’ adaptor was ligated using T4 RNA Ligase 1 - high concentration (NEB) and 10 mM ATP ...
-
bioRxiv - Microbiology 2021Quote: ... 5’UTR was obtained using the Template Switching RT Enzyme Mix (NEB #M0466) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: 5’ linker ligation (1x PNK buffer, 40 u T4 RNA ligase I (NEB), 80 u RNaseOUT ...
-
bioRxiv - Genomics 2021Quote: ... In step 5 extra free oligo was removed by Thermolabile Exonuclease I (NEB). After adding 50 ng of carrier DNA (poly (A) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA 5′ ends were phosphorylated with T4 polynucleotide kinase (New England Biolabs). Adapters were ligated to the 5′ and 3′ ends of the RNA and first-strand cDNA synthesis was performed using M-MLV reverse transcriptase ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 µL reaction volume contained 2.5 µL Luna® Universal qPCR mastermix (NEB). RT-qPCR analyses were performed using the Real-time PCR Roche Lightcycler 480 and the expression of PP2AA3 (At1G13320 ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ end phosphorylation (1x PNK buffer, 20 U T4 PNK (NEB, Cat# M0201L), 80 U RNaseOUT ...
-
bioRxiv - Microbiology 2022Quote: ... Isolated DNA (5 μg) was digested overnight with PstI-HF (New England Biolabs) and resolved on a 0.7% 1x TBE agarose gel stained with SYBR Safe (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... 50 μl of MNAse digestion buffer (5 gelUnits/μl Micrococcal Nuclease (NEB M0247S), 2X Micrococcal Nuclease buffer ...