Labshake search
Citations for New England Biolabs :
1751 - 1800 of 2481 citations for Dengue Virus Serotype 2 Envelope Protein HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and AT1G66100 which encode a PR (pathogenesis-related) protein were amplified using the Phusion High-Fidelity DNA Polymerase (New England Biolabs) from Col-0 genomic DNA with two primer pairs RBCS2B-BglII-PF (5′-CCAGATCTGGAATATTCAATGTTGACTATC-3′ ...
-
bioRxiv - Molecular Biology 2023Quote: ... by replacing the green fluorescent protein (GFP) with a mCherry reporter using the NEBuilding HiFi DNA Assembly Cloning Kit (New England Biolabs) (Ran et al. ...
-
bioRxiv - Neuroscience 2023Quote: RNA was released from the beads through protein K lysis (Monarch® Total RNA Miniprep Kit; New England Biolabs, #T2010S). After lysis ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... TIS11B protein-RNA complexes were immunoprecipitated from 1 ml of crosslinked lysate and washed with high salt and PNK buffer (NEB). RNA was repaired by 3′ dephosphorylation and ligated to L3-IR adaptor on beads ...
-
bioRxiv - Molecular Biology 2023Quote: Expression vectors encoding His6/SUMO-tagged SAHS proteins were obtained from Twist Bioscience and transformed into LEMO21(DE3) competent cells (New England Biolabs) according to the provider’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Coli vectors expressing SAHS proteins without SUMO tags were ordered and synthesized from Twist Bioscience and transformed into LEMO21(DE3) competent cells (NEB). To test for the effects of intracellular SAHS expression ...
-
bioRxiv - Cell Biology 2023Quote: ... myc-tagged AP3B1 immunoprecipitated and immobilised on Protein G-sepharose beads was incubated with CK2 (250 units; New England Biolabs) for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... the reaction was stopped with a final concentration of 50 mM EDTA and the proteins were removed by treatment with proteinase K (1/100 of the volume – NEB) and SDS (0.1% ...
-
bioRxiv - Genomics 2024Quote: Each of the fragmented protein factor-enriched chromatin sample was mixed with 50 µg/ml of BSA (cat# B9000S, NEB) to prevent chromatin aggregation ...
-
bioRxiv - Microbiology 2024Quote: ... reactions were performed in a final volume of 100 μl using the PURExpress ΔRibosome In vitro Protein Synthesis Kit (New England Biolabs) according to the manufacturer instructions and with ribosomes purified from E ...
-
bioRxiv - Plant Biology 2024Quote: ... in an N-terminal fusion (MIROs are tail anchored proteins) with mCherry that was generated by Gibson assembly (New England Biolabs, Ipswich ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 40 – 50 µg of protein lysate from each sample was denatured in 1X Glycoprotein Denaturing Buffer (Cat.#B1704S; New England Biolabs) with 20 µL total volume at 100°C for 10 min ...
-
bioRxiv - Biochemistry 2024Quote: In vitro translation was monitored by the production of luciferase signal in a PURExpress in vitro protein synthesis kit (NEB), using firefly luciferase mRNA as an input ...
-
bioRxiv - Cell Biology 2024Quote: ... under a CamKII promoter were both restriction digested with AgeI and the HALO protein was ligated with Quick Ligase (NEB) into the ER-GCaMP yielding the CamKII ER-Halo-GCaMP6-150 ...
-
bioRxiv - Biochemistry 2024Quote: ... a pET-derived vector that is normally used for T7 RNA polymerase-dependent protein expression (AVA421) was linearized by digestion with XbaI (NEB) in a reaction containing 1X CutSmart buffer and 0.5 U/μl XbaI to be used for run-off transcription using T7 RNA polymerase to transcribe the first 26 nucleotides following the T7 promoter sequence to generate the standard model RNA substrate ...
-
bioRxiv - Bioengineering 2024Quote: ... and mCherry inserts were generated via PCR and cloned into the linearized viral backbone as a single fusion protein using HiFi cloning mix (NEB). H2B-iRFP nuclear marker was (Addgene Plasmid #90237) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Template DNA for in vitro protein synthesis was generated with Phusion® Hot Start Flex DNA Polymerase (NEB. Ipswich MA) using gBlocks as template and flanking primers (Supplementary Table S2) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 ng of unlabeled crRNA was mixed with equal volume of 2 × RNA loading dye (New England Biolabs) and fractionated in the 12% denaturing polyacrylamide gel ...
-
bioRxiv - Cell Biology 2019Quote: ... We incubated our cells in complete medium containing 2 μM of SNAP-Cell TMR-Star (New England Biolabs) during 20 min to label all pre-existing available SNAP-tag (Pulse) ...
-
bioRxiv - Cell Biology 2020Quote: ... MNase (non-specific DNA digestion) used MNase buffer and 2 μL of enzyme (20 units/μL) PvuII (NEB), AluI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were deglycosylated with PNGase F by adding 5μl of a solution consisting of 18μL of Glycobuffer 2 (10x) and 27μL of PNGaseF (NEB, P0708S). Endoproteinase Lys-C (Promega) ...
-
bioRxiv - Genomics 2020Quote: ... 1 mM ATP and 10 mM DTT and with 1 μl (2 U/μl) of RNase H (NEB), 1 μl (3 U/μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... Methylated adapters (RRBS-1, RRBS-2; Table 1) were added by ligation using DNA ligase (New England Biolabs). DNA was purified using ratio of 1:1.2 sample to AMPure XP beads ...
-
bioRxiv - Genomics 2020Quote: ... After 2 rounds of SPRI cleanup the libraries were eluted in EB buffer and USER enzyme mix (NEB) was used to digest the second strand cDNA ...
-
bioRxiv - Genomics 2019Quote: ... We treated 2 µg debranched DNA using the UltraII end repair/dA-tailing enzyme mix (New England Biolabs) followed by a purification using a 0.6 volume ratio of AMPure beads ...
-
bioRxiv - Genomics 2019Quote: ... is manually added to each well using a multichannel pipette followed by 2 µL of lysis buffer (0.2 µL of 25 µg/µL Qiagen Protease, 0.2 µL of 10x NEB Buffer 4 and 1.6 µL of nuclease-free water ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 ng of PCR product of RFLP_region 1 and RFLP_region 2 were digested with PstI (New England Biolabs) and VspI (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: 5μl of the first-strand reaction was mixed with 7.5μl of OneTaq HS Quick-load 2× (NEB, #M0486L) and 2.5μl water and amplified for three PCR cycles following the program ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 μL of NEB Buffer 2 and 15 μL of 25 U/μL MboI restriction enzyme (NEB, R0147) were then added ...
-
bioRxiv - Cell Biology 2019Quote: ... at 30°C for 1 hour in a total volume of 50μl PMP phosphatase buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, 1 mM MnCl2; New England Biolabs).
-
bioRxiv - Biochemistry 2019Quote: ... only the cells expressing iRFP-tau WT were treated with 2 U/μL λPP (New England Biolabs # P0753) for 3 hours at 30 °C with gentle rotating ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50 µL of NEB Buffer 2 and 15 µL of 25 U/µL MboI restriction enzyme (NEB, R0147) were then added ...
-
bioRxiv - Genomics 2021Quote: ... phage particles were lysed at 56 °C for 2 h in 550 μL of lysis buffer (100 mM Tris-HCl at pH 8.0, 27.3 mM EDTA, 2% SDS, ~1.6 U Proteinase K [NEB #P8107]). After lysis ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were incubated with 2 nM benzylguanine-Alexa Fluor 647 (New England Biolabs, SNAP-Surface Alexa Fluor 647) or custom synthesized SNAP substrate benzylguanine-DY549P1 for 30 min before an experiment ...
-
bioRxiv - Biochemistry 2020Quote: ... by incubating the cells with 2 μM ATTO594-Coenzyme A and 1 μM phosphopantetheine transferase (New England Biolabs) in Ham’s F12 medium without FBS at ~25°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... transposed DNA was PCR amplified with 12 cycles using Next High-Fidelity 2×PCR Master Mix (NEB, M0541) with Nextera DNA CD Index primers ...
-
bioRxiv - Systems Biology 2020Quote: ... The purified transposed DNA was amplified with NEBNext High-Fidelity 2 X PCR Master Mix (New England Biolabs) and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... After digestion the plasmid vector and insert were added to Gibson assembly master mix (1.5 µl insert, 0.5 µl vector, 2 µl master mix) (New England BioLabs) and incubated at 50 °C for 1 hr ...
-
bioRxiv - Microbiology 2021Quote: ... and was then installed with 5’cap (Vaccinia Capping System, NEB, USA; Cap 2’-O-methyltransferase, NEB, USA) and 3’ Poly(A ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were pre-treated with 0.5 mM ATP and 2.5 U casein kinase 2 (CK2) in 1X CK2 buffer (NEB) for 15 min at 30°C ...
-
bioRxiv - Immunology 2022Quote: T7 endonuclease I digestion: 200 ng of purified DNA amplicons were annealed with 1X NEBuffer 2 (NEB, # B7002S) and total volume was brought up to 19 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μL of 2 mM dNTP and 0.5 μL (2.5 U) of DNA polymerase I Klenow fragment (New England Biolabs) were added to the reaction mixture ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Immunology 2022Quote: ... Final amplification PCR was performed as described before by adding 8 µl of 2 x PCR MM (NEB) with number of cycles according to qPCR (usually Cq values were around 20) ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids coding for segments 2 and 8 were digested using BbsI restriction enzyme (New England Biolab, NEB), the plasmid coding for segment 10 was linearized with BsaI (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... and an additional hour after the addition of 2 U/ 50 µl of DNase (New England Biolabs, Inc.). The RNA samples were purified using an 8% Acrylamide:Bis-Acrylamide (29:1 ...