Labshake search
Citations for New England Biolabs :
1951 - 2000 of 2481 citations for Dengue Virus Serotype 2 Envelope Protein HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of iTP_3’_linker_ApoI (10 μM) and 0.5 μl of ligase (T4 RNA ligase 2, truncated - 200 000 U/ml - New England Biolabs) per reaction ...
-
bioRxiv - Genetics 2023Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Microbiology 2023Quote: The pGEX-6P-PrkA1-338 plasmid (Table 2) was constructed by a two-part ligation (NEB Quick Ligation kit) of BamHI- and NotI-linearized pGEX-6P and PCR-generated prkA1-338 amplified with primers AS21 and AS81 (Table 3 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified pegRNA/ngRNA pair sequences from each sample using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... To produce the ABI1 Isoform 2 deleted SH3 domain we performed Q5 site-directed mutagenesis (New England Biolabs Inc.) with forward primer 5’-TAGCTCGAGGTTAACGAATTC - 3’ and reverse primer 5’-TTTCTCAATATAATTCTTGGGG - 3’ synthesized by IDT and then verified the sequence (Genewiz) ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified PCR products were ran on 2% agarose gel and stained with ethidium bromide solution (New England Biolabs Inc.). Gel photographs were taken using ChemiDoc MP gel documentation system (BIO-RAD).
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Biochemistry 2023Quote: IVT and co-transcriptional capping reactions were performed in 30 μL reactions containing 1x T7 RNA polymerase buffer (40 mM Tris-HCl, 20 mM MgCl2, 1 mM DTT, 2 mM spermidine, pH 7.9; New England Biolabs), 5 mM each NTPs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barcoded 3’ adapters (see Extended Data Table 1) were ligated using K227Q truncated T4 RNA ligase 2 (NEB, M0351L) at a concentration of 0.5 µM adapter and in the presence of 25% PEG8000 containing a homemade 10 x ligation buffer (0.5 M Tris pH 7.8 ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 0.5 μl of 100 mM phenylmethylsulfonyl fluoride] and incubated with micrococcal nuclease (2 × 103 U/ml; New England Biolabs) for 2 hours at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Single cells of two untreated CeD patients were sorted into 96-well plates containing 2 µl of scRNA-seq catch buffer (0.2% vol/vol Triton X-100 [Sigma] in H2O with 2 U/μl RNase inhibitor [New England Biolabs]) per well using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Immunology 2023Quote: ... and ligated with custom UMI adapters (IDT) (Table S2) at 2 uM according to NEBNext Ultra II instructions (NEB). Libraries were prepped following NEBNext Immune Sequencing Kit’s protocol (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were digested with 0.4 μl of restriction enzyme NlaIII for 2 hours at 37°C (New England Biolabs). Digested PCR products were run on 2% agarose gels with SYBR Safe (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... for the elution from the columns 2 pg of Tn5-digested and purified lambda DNA (New England Biolabs, # N3011S) were added to be used as spike-in normalizer for later analysis ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized with ice-cold permeabilization buffer (1X-PBS, 0.5% Triton X-100, 2 mM vanadyl-ribonucleoside complex (New England Biolabs)) for 4 min on ice ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μL i7 unique index primer (10 μM) and 25 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB) were added to 21 μl of purified CUT&TAG DNA ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of isolated phage T4 in Pi-Mg buffer was used as a PCR template in the first PCR with the following reaction mix: 0.125 µM each primer (Supplementary Table 2) in 1x High Fidelity Master Mix (NEB) with a total volume of 10 µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.01 pmol (2:1 molar ratio of insert:backbone) library and 2.5 uL NEBuilder HiFi DNA Assembly Master Mix (NEB E2621) and incubated at 50 °C for 60 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: Protein G magnetic beads were washed 2-3x with 1ml blocking buffer (20 mM Hepes, 150 mM KCl, 20% Glycerol, 0.5 % Tween, BSA (Biolabs), Heparin 0.2 mg/ml ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR reactions contained 2 μl cDNA in 50 μl PCR reaction with Phusion Hot Start Flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of PURExpress sample was mixed with 300 ng of ΦX174 Virion DNA (ssDNA substrate, NEB Ipswich MA) or ΦX174 RF I DNA (dsDNA substrate ...
-
bioRxiv - Molecular Biology 2020Quote: Cleavage of the MBP tag from NlGr7 was completed according to manual instructions of the pMAL protein fusion and purification system (NEB, Inc, USA). The tag (MBP ...
-
bioRxiv - Molecular Biology 2020Quote: ... the desired sequences pertaining to the truncated forms of the N protein were subcloned from the synthetic gene using polymerase chain reaction (Phusion polymerase, New England Biolabs, Hertfordshire, UK). All genes were cloned into the modified pet28 vector and gene sequences were confirmed by Sanger Sequencing.
-
bioRxiv - Biochemistry 2022Quote: ... purified Trx-FER-KD and FER-KDK565R proteins were treated with 1 μl of λ-phosphatase (λ-PP) (400,000 units/ml, New England Biolabs. P0753S) and 1 mM MnCl2 for 1-2 h at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl of the gRNA mixture was mixed with Cas9-NLS protein (final concentration of 5 μM. New England Biolabs, Ipswich, USA), 2M KCl (final concentration of 300mM) ...
-
bioRxiv - Microbiology 2021Quote: ... 39 μl of each lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units ...
-
bioRxiv - Genetics 2020Quote: ... Zebrafish embryos were injected at the 1-cell stage with a 1 nL solution of bbs2 gRNA (200 ng/μL) and Cas9 protein (10 μM; New England BioLabs, Beverly, MA). Mutagenesis was confirmed by High Resolution Melt Analysis (HRMA ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins (except from cells expressing eGFP and cytoplasmically tagged EGFR) were further treated with 250 U of PNGase F (NEB, Cat# P0704) for 1 hour at 37 °C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or four (white shavenbaby experimental) sgRNA targeting the first or second exon (100 ng/μl) and CAS9 protein (EnGen Spy Cas9 NLS from NEB, Catalog # M0646M). The distribution of the major trichome height for the white control was normal (Shapiro-Wilk normality test W = 0.9637 ...
-
bioRxiv - Microbiology 2024Quote: ... 39 μl of each benzonase-treated lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1 μl (400 units ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 - 400 ng of PCR fragments were used as template DNA to synthesize analytic amounts of DNA deaminases using PURExpress In Vitro Protein Synthesis kit (NEB, Ipswich, MA) following manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were incubated at 37°C and stopped for indicated time periods and the reaction was stopped by addition of 2 × RNA loading dye (New England Biolabs). For electrophoresis ...
-
bioRxiv - Genetics 2021Quote: ... input genomic DNA was amplified in a 20 μL reaction for 25 cycles using NEBNext High-Fidelity 2× PCR Master Mix (NEB). PCR products were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was buffer exchanged into enterokinase cleavage buffer (20 mM Tris pH 8, 50 mM NaCl, 2 mM CaCl2) and cleaved using bovine enterokinase (EK, NEB) at 16U/mg protein for 4 hrs ...
-
bioRxiv - Microbiology 2020Quote: ... This gBlocks fragment and a NdeI-HindIII-digested pET21b backbone were assembled together using a 2× Gibson master mix (NEB). Gibson assembly was possible due to a 23-bp sequence shared between the NdeI-HindIII-cut pET21b backbone and the gBlocks fragment ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA (2 μL) was used as template in 50 μL PCR reaction with Phusion Hot start flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Genomics 2020Quote: ... Beads containing the ssDNA extension products were suspended in 10 μl of polyadenylation master mix containing 2 units of terminal transferase TdT (New England Biolabs), 1x TdT buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lenti-sgRNA puro vector was digested with EcoRI for 2h at 37°C followed by digestion with BsmBI for 2 hours at 55°C and treatment with 4 μl of rSAP (NEB) for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAse I digestion to analyse 2’-O-ribose methylation was done in the presence of 10 U T4 PNK (NEB) in 50 mM Tris-acetate (pH 6.5) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Labelling of total histones was performed by a 30 min-pulse with 2 µM of the SNAP-cell SiR-647 reagent (New England Biolabs) followed by 30 min wash in fresh medium.