Labshake search
Citations for New England Biolabs :
1751 - 1800 of 6282 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion constructs were made by PCR amplification of the appropriate regions and cloned into the Cilantro 2 vector using Gibson cloning (New England Biolabs). Lentiviral particles carrying the respective constructs in the Cilantro 2 vector were produced and used to transduce MOLM-13 cells as described above ...
-
bioRxiv - Biochemistry 2024Quote: ... pETDuet-1 vector was linearized by digestion with PacI and NdeI and gene fragments were inserted into multiple cloning site 2 (MCS2) of the linearized plasmid via Gibson assembly using the New England BioLabs (NEB) Gibson Assembly Master Mix and following the manufacturer’s standard protocol ...
-
bioRxiv - Genomics 2024Quote: ... with a final extension of 72 °C for 2 minutes using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493L). We used 7 cycles for all amplicons ...
-
bioRxiv - Plant Biology 2024Quote: ... To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). The resulting construct was introduced into Hi-II immature embryos by Agrobacterium-mediated transformation ...
-
bioRxiv - Plant Biology 2024Quote: To obtain CRISPR-Cas9 mutant alleles of RELK2 and RELK3 a dual targeting guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... crRNAs were amplified from genomic DNA (primer sequences can be found in (Supp. Table 2) using Q5 2x Master Mix (NEB) in 100 μL reactions with the following thermal cycling parameters:
-
bioRxiv - Microbiology 2024Quote: ... was amplified using primers OVL7966 and OVL6481 and the PCR product was excised from a 2% agarose gel using the Monarch DNA cleanup and gel extraction kit (NEB). One-step Golden Gate Assembly (GGA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 0.2 μl 50x oligos of the AarI recognition site for Level 0 and Level 2 cloning or Eco31I/BsaI-HFv2 (ThermoFisher/NEB) for Level 1 cloning ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 µM NGFR121W-SNAP was coupled with 3 µM BG549 surface (NEB # S9112) for 1 hour at 37°C in calcium imaging (CIB ...
-
bioRxiv - Genomics 2022Quote: ... We ligated a 3’ adapter ligation using T4 RNA Ligase 1 (NEB, M0204L). We performed a second bead binding followed by a 5’ decapping with RppH (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
bioRxiv - Cell Biology 2024Quote: ... then 1 μL Endo H and 2.5 μL GlycoBuffer 3 (New England Biolabs) was added and incubated for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 µl aliquots were 5’ adapter ligated (25 µl of 1× T4 RNA ligase buffer (NEB), 1 mM ATP ...
-
bioRxiv - Cell Biology 2020Quote: ... After ligation at RT for 4 h with T4 ligase (NEB), the nuclei were pelleted ...
-
bioRxiv - Genomics 2020Quote: ... with 4 μl (400 U/μl) of T4 DNA ligase (NEB) in a final volume of 200 μl at 16°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 μL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 h at 55 °C ...
-
bioRxiv - Immunology 2022Quote: ... 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Bioengineering 2021Quote: ... 2.5 µL of 4 mM dNTPs (New England Biolabs, Ipswich, MA), and SuperScript II RT Enzyme (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... and 4 μl of T4 DNA polymerase (NEB M0203, 3U/μl), and incubating at 37 °C for 1 hour with rotation ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplied with the enzyme) and 4 units of DNAse I (NEB) were incubated at 37 °C for 60 min ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFD4_Lamp_13 pCFD4_lamp1-30_4-4 were made by Gibson assembly (NEB # E5510S) using oligos Lamp1_crips_61_for ...
-
bioRxiv - Immunology 2022Quote: ... 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Molecular Biology 2022Quote: ... and α1-3,4 fucosidase (New England Biolabs, 4 U/μg protein). All enzymatic reactions were performed as a 1-step reaction with 1x Glycobuffer 2 (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 hours at 55°C ...
-
bioRxiv - Pathology 2021Quote: ... 4 μM of each gRNA was combined with Cas9 (NEB #M0646) and Cas9 buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL NEBNext Second Strand Synthesis Enzyme Mix (New England Biolabs), and 48 μL water ...
-
bioRxiv - Genomics 2022Quote: ... but instead incubated with 4 units of Dam enzyme (NEB, M0222L) during the activating step ...
-
bioRxiv - Plant Biology 2022Quote: ... Supernatants were treated with 4 µL of DNAse I (NEB, EN0521) and incubated for 10 min at 37°C with shaking at 1,200 rpm ...
-
bioRxiv - Systems Biology 2024Quote: ... Samples were then treated with 4 units of DNase I (NEB) for 1 hr at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μl of 6x Gel Loading Dye (B7025S, New England Biolabs) and 1 μl of 2.5 mg/ml EtBr were added to the RNA size markers.
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 h at 55 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 units of BstBI (R0519 New England Biolabs Inc., Ipswich MA) was added ...
-
bioRxiv - Immunology 2023Quote: ... 4 U/μL Exonucluease I (New England Biolabs, cat.: PN MO293L) was added to the preamplification mix and incubated in the thermocycler for 30 min at 37°C and 15 min at 80°C to remove non-incorporated primers.
-
bioRxiv - Synthetic Biology 2023Quote: ... 4-5 cycles of PCR with OneTaq polymerase (New England Biolabs) was performed using the forward (pBPS_fwr ...
-
bioRxiv - Microbiology 2024Quote: ... followed by a 4-hour linearization with XbaI endonuclease (NEB, Canada) at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... The Biotin-handle and Cosmid-I95 DNA were both digested for 2 hours at 37°C with SpeI-HF (NEB, R3133L) and subsequently heat inactivated for 20 minutes at 80°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were run on 2% agarose gels and the Quick load 100pb DNA ladder (New England Biolabs Inc., Ipswich, MA) was used for fragment size visualization ...
-
bioRxiv - Physiology 2020Quote: ... Germany) 1.5% agarose gel using purple gel loading dye and 2-Log DNA ladder (both New England Biolabs, Ipswich, MA, USA) at 80 V and 85 mA for 2h ...
-
bioRxiv - Neuroscience 2019Quote: ... Fixed neurons were then permeabilized and blocked simultaneously (2% normal goat serum, 5425S, New England Biolabs, and 0.1% Triton X-100) before incubation in primary antibody solutions overnight and subsequent incubation with secondary antibodies the following day.
-
bioRxiv - Cell Biology 2019Quote: ... Each sample was then split into two and incubated in the presence or absence of 2 μl of EndoH (50 U/μl: NEB#P0702S) for 1h at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The amplification of bacterial DNA was achieved by targeting the V3–V4 region of 16S rRNA gene with 30 µL final volume containing 15 µL of 2× master mix (BioLabs, USA), 3 µL of template DNA ...
-
bioRxiv - Genomics 2021Quote: Restriction digestion was carried out by adding 25 μL of 10 ×NEBuffer 2 and 100 U of the MluCI restriction enzyme (NEB, R0538) and incubating for ≥2 hours at 37°C in a Thermomixer at 900 rpm ...