Labshake search
Citations for New England Biolabs :
1701 - 1750 of 3396 citations for 5 Fluoro 2 piperidin 2 yl 1H benzimidazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Subsequent 5’ dephosphorylation by CIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 5 µL SbfI-HF (NEB R3642L), 50 µL 10x CutSmart NEB buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli (NEB 5-alpha competent cells), isolated using the Monarch Plasmid preparation kit (NEB ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genetics 2020Quote: ... and 5 μl CviAII (NEB R0640S). The digestion was performed at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 units of Taq polymerase (NEB), and 5 pmoles each of the following primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-phosphorylated with T4 PNK (NEB) and annealed oligonucleotides were used for UP-homology (oBA1761/oBA1762 or oBA1765/oBA1766) ...
-
bioRxiv - Neuroscience 2022Quote: ... Subsequent 5’ dephosphorylation by quickCIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... NEB 5-alpha (New England Biolabs), or XL-10 Gold (Agilent ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 ul 10X PNK buffer (NEB), 1 ul RNaseOUT ...
-
Removal of Spo11 from meiotic DNA breaks in vitro but not in vivo by Tyrosyl DNA Phosphodiesterase 2bioRxiv - Molecular Biology 2019Quote: ... 5 units of lambda exonuclease (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 5× Phusion HF buffer (NEB, USA), a dNTP nucleotide mix containing 200 μM of each nucleotide (Promega) ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... 5 U lambda exonuclease (NEB M0262S), and 20 U E ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 U of T4 PNK (NEB) were included in the initial NsiI digestion reaction and incubated at 37 °C for one hour.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl ExoI buffer (NEB, B0293S), 5 μl CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl CutSmart buffer (NEB, B7204S), and 30 μl nuclease-free water and incubated for 1 hour at 37 °C and 10 minutes at 80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNase H (5 U, NEB, M0297S) was added followed by incubation at 37 °C for 20 min and 65 °C for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg/ml DNase I (NEB), 1x PhosStop phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
mRNA vaccines and hybrid immunity use different B cell germlines to neutralize Omicron BA.4 and BA.5bioRxiv - Immunology 2022Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Microbiology 2022Quote: ... or exonuclease III (NEB, 5 units) were performed on 2 – 3 μg of DNA extracted from virus particles for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha (NEB) according to the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BsaI-HFv2 (NEB, R3733L), 250 U T4-ligase and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... and Adenosine 5’-Triphosphate (ATP) (NEB). After RNA recovery using an RNA MinElute Cleanup Kit (QIAGEN) ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL High GC Enhancer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL High GC Enhancer (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 5 µl 10x CutSmart buffer (NEB), 1 µl PsiI enzyme (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... 5 uL 5X Phusion Buffer (NEB), 10 uL 1M Trehalose (Life Sciences Advanced Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...
-
bioRxiv - Immunology 2023Quote: ... 5 µL of GC Enhancer (NEB), 5 µL of 5X buffer ...
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Genomics 2023Quote: ... or 5 U MboI (NEB R0147S) in 15 μl rCS buffer for 1 h at 37°C and analysed in a 1.2% agarose gel containing ethidium bromide ...
-
bioRxiv - Immunology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart 10x (NEB), 2 μl of BSA (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of Antarctic Phosphatase (NEB) and 10 mU/µL of phosphodiesterase I (PDEI ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...