Labshake search
Citations for New England Biolabs :
1601 - 1650 of 3396 citations for 5 Fluoro 2 piperidin 2 yl 1H benzimidazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... RecBCD (NEB, 5 U), NcoI- HF (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... supernatant was discarded and fill-in mix was added (38 μM Biotin-14-dATP [Thermo Fisher Scientific], 38 μM dCTP, dGTP and dCTP [Thermo Fisher Scientific], 50 U Klenow Polymerase [NEB], 1x NEB 2 buffer) and cells incubated for 1 h at 37 °C under rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... nuclei were spun down and resuspended in fill-in mix (biotin-14-dATP [Thermo Fisher Scientific], dCTP, dGTP and dTTP [Thermo Fisher Scientific], Klenow Polymerase [NEB], 1x NEB 2 buffer) for 1.5 h at 37°C with rotation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 10 µg of vector and 1 µg of amplicon were digested overnight with 2 µl (vector) or 0.5 µl (amplicon) each of SphI-HF® and NsiI-HF® (New England Biolabs, catalog no. R3127) in a total volume of 50 µl ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of RNA was used for cDNA library construction using an NEBNext® Ultra 2 RNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, MA) according to the manufacturer’s protocol ...
-
Cis-regulatory divergence underpins the evolution of C3-C4 intermediate photosynthesis in MoricandiabioRxiv - Plant Biology 2021Quote: ... 17 μl total RNA (100 ng/μl) was added with 2 μl buffer and 0.5 μl RNase-free DNaseI enzyme (New England Biolabs GmbH, Frankfurt am Main, Germany) incubating on ice for 30 s ...
-
bioRxiv - Molecular Biology 2022Quote: ... Beads were washed as described above and either directly resuspended in Proteinase K reaction or in 20 μl of RecJ adapter removal reaction (1X NEB Buffer 2 (NEB, #B7002S), 25U 5’ Deadenylase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA templates for transcription were obtained by PCR amplification of the psiCheck-2 vectors using a forward primer containing an SP6 promoter sequence by Phusion HF polymerase (NEB, USA, Cat. No. M0530S). After transcription ...
-
bioRxiv - Genomics 2022Quote: ... and the presence or absence of one of two RNAse inhibitors (1 – Millipore Sigma, Protector RNAse Inhibitor, Cat. No. 3335399001; 2 – NEB, RNAse Inhibitor, M0314S). The RNA was then extracted from the tissue using the miRNeasy kit (Qiagen Cat ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Genomics 2020Quote: ... Between 100 and 200 ng of genomic DNA was digested using 2 units of the MslI restriction enzyme (New England Biolabs ®, Ipswich, Massachusetts, USA.) and using 1 unit of NEB4 buffer in 20 μl of volume and for 2 hours at 37 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was converted into double stranded blunt-end libraries with Illumina-specific adapters REF using the NEBNext DNA Sample Prep Master Mix Set 2 (E6070S - New England Biolabs Inc., Beverly, MA, USA) following the manufacturer’s protocol ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase I (NEB). The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Genomics 2022Quote: ... and followed by a 5′ decapping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S). The 5′ end was phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of nuclease-free water and 5 µL of GA mastermix (NEB) were added and incubated at 40°C for a minimum of 1.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 mM G(5’)ppp(5’)G RNA Cap Analogue (New England Biolabs), 4 μg DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of 5’ adaptor required (i) Removal of the 5’ cap using RNA 5’ pyrophosphohydrolase (RppH, New England Biolabs, Ipswich, MA, M0356S) (ii ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 µL of the PCR product was incubated with 2 U of EcoRI-HF® in 1X CutSmart® Buffer (New England BioLabs, Ipswich, MA, USA) at 37°C for 60 minutes ...
-
bioRxiv - Genomics 2019Quote: ... were ligated onto Hi-C ligation products bound to streptavidin beads for 2 hours at room temperature (T4 DNA ligase NEB, in ligation buffer, slowly rotating). After washing twice with wash buffer (5 mM Tris ...
-
bioRxiv - Neuroscience 2021Quote: A total amount of 0.4 ug of RNA was used for cDNA library construction at Novogene using an NEBNext® Ultra 2 RNA Library Prep Kit for Illumina® (cat NEB #E7775, New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... The DNA length and RNA absence were assessed by 2% agarose gel electrophoresis (50 V, 90 min) including the Quick-Load 1 kb DNA Ladder (New England Biolabs Inc., Ipswich, USA; Text S1). The extracted gDNA was not fragmented and larger than 10 kb (Fig ...
-
bioRxiv - Biophysics 2023Quote: ... linker (listed in Supplemental Table S6) was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (New England Biolabs #M0373, 400 units per sample) in T4 Ligase reaction buffer (New England Biolabs #B0216 ...
-
bioRxiv - Biochemistry 2020Quote: ... in the presence of m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB). 5 μg DENV-Luc RNA was electroporated into 2×106 Vero cells ...
-
bioRxiv - Genetics 2022Quote: ... The m7G(5’)ppp(5’)G RNA Cap (New England BioLabs, catalog number S1404L) was used as Cap Analog with 4:1 of Cap Analog:GTP ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ ends were dephosphorylated using 5 U of Antarctic phosphatase (New England BioLabs/M0289S). A mix containing the RNA sample (~10 pmol) ...
-
bioRxiv - Genomics 2024Quote: ... the 5’ end of RNAs were enzymatically modified with RNA 5’ Pyrophosphohydrolase (RppH; NEB) and hydroxyl repair was performed using T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL T4 PNK (NEB), and 1 µL Klenow large fragment (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL CutSmart buffer (NEB), and 30 μL of nuclease-free water and incubated for 1 h at 37 °C and 10 min at 80 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL HinFI enzyme (NEB), 5 μL ExoI buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL ExoI buffer (NEB), 5 μL CutSmart buffer (NEB) ...