Labshake search
Citations for New England Biolabs :
1551 - 1600 of 3396 citations for 5 Fluoro 2 piperidin 2 yl 1H benzimidazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR was performed with 2 μl of the reverse transcription positive reactions and Phusion High Fidelity DNA polymerase (NEB, Ipswich, MA) following manufacturer’s protocols on an Applied Biosystems 2720 Thermal Cycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... Beads were washed 2 times with EB2 without NaF or PhosStop and one time with λpp buffer (New England Biolabs, Ipswich, MA) before resuspension in 40 μl of λpp buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... spanning the whole SARS-CoV-2 genome were amplified using the high-fidelity proofreading enzyme Q5® High-Fidelity DNA Polymerase (NEB, M0491L) in a 25 µL reaction volume using respective primers (fig ...
-
bioRxiv - Synthetic Biology 2023Quote: BigBlocks were PCR-amplified with dedicated primer pairs in a 25.0 μL PCR reaction mix composed of 0.25 μL Q5® Hot Start High-Fidelity DNA Polymerase 2 U/μL (NEB® M0493), 5.0 μL Q5® 5X buffer (NEB® B9027) ...
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Immunology 2023Quote: ... PCR was performed with 2 ng of library input per reaction and 7 cycles of amplification using Q5 DNA polymerase (New England Biolabs, catalog # M0491S). Libraries were quantified using a Qubit 4 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were selected for cDNA target fragments of 200 bp on 2% low-range Ultra agarose followed by PCR amplification using Phusion DNA polymerase (NEB, United States) for 15 PCR cycles ...
-
bioRxiv - Microbiology 2023Quote: ... 9 DNA fragments encoding the partial genome of SARS-CoV-2 were prepared by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Cat# M0491S). A linker fragment encoding hepatitis delta virus ribozyme ...
-
bioRxiv - Genomics 2024Quote: ... after which 68 µL RNase-free H2O was added with 10 µL DNase I Buffer and 2 µL DNase I (New England Biolabs, Ipswitch, MA). The resulting mix was incubated for 15m at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... mCherry-2-L and the PIF5 coding sequence into pJHA212G80 containing the rbcS terminator using Gibson Assembly (New England Biolabs, Ipswich, MA). The resulting construct was transformed into pif5-3 using Agrobacterium-mediated transformation ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37° C for 2 hrs from 1 µg purified dsDNAs using a T7 high yield RNA synthesis kit (NEB, Cat # E2040S) in a total volume of 20 µL ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 2 ng of RNA per sample using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB, E6420). Libraries were pooled and sequenced using a P3-100 kit from Illumina in a NextSeq2000 sequencer following manufacturer’s instructions.
-
bioRxiv - Biochemistry 2024Quote: ... 100 ng of template DNA was used in a 2 hour in vitro transcription reaction using the HiScribe T7 High Yield RNA (New England Biolabs, Cat. E2040S) kit according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... coli (Suppl. Table 1) were cloned into a pBAD24 with ampicillin resistance using the USER cloning method (New England Biolabs, Table 2). All sequences were cloned including a 10x histidine tag located in the N-terminus for BtuG1-3 and the C-terminus for BtuG2 and all its mutants ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were split into two separate reaction tubes containing 8 μL of PCR product + 1 μL 10X NEB® Buffer #2 (New England Biolabs®). These were incubated in a thermocycler with an initial denaturation of 95 °C for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Immunology 2021Quote: ... and ROI 2 were amplified from C57BL/6 genomic DNA by PCR using the Q5® High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA). PCR products were ligated into pSCB-Amp/Kan using the StrataClone Blunt PCR Cloning Kit (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... the EcoRI inverse PCR yielded a desired length of 2 kb of promoter sequence but for duck and quail less than 2 kb of the promoter was initially sequenced so inverse PCR was repeated using XbaI (R0145S, NEB, Ipswich, MA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... Briefly 60 ng ±10% of total RNA was subjected to small RNA library preparation by using the NEBNext Multiplex Small RNA Library Prep Set 1 and 2 for Illumina (NEB, Ipswich, MA, USA) kit according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... Semi-quantitative analysis was conducted using standard PCR amplification (Q5 Hot-Start High-Fidelity DNA polymerase; NEB, Ipswich, MA, USA, and agarose (2%) gel electrophoresis ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µ l of cfDNA was incubated at 37°C for 1 hour with the following reaction mixture: NEBuffer™ 2 (NEB, B7202), 0.25 mM MnCl2 (SIGMA ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA). The expression of each transcript was calculated according to the transcripts per million reads method ...
-
bioRxiv - Molecular Biology 2021Quote: Variants of concern (VOC) of SARS-CoV-2 were created with Q5® Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... 500 ng total of the purified PCR products were mixed with 1 μl 10× NEBuffer 2 (New England Biolabs Inc., Beverly, MA, USA) and ultrapure water to a final volume of 9.75 μl ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ phosphate-containing rsmY and rsmZ amplicons were then ligated to the linearized dephosphorylated L4440 vector using a 2-hour room temperature incubation with T4 DNA ligase (NEB Cat. No. M0202S) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All DNA fragments were indexed using NEBNext Multiplex Oligos for Illumina (Dual Index Primer sets 1 and 2, New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids cleavage was conducted at 37 °C for 10 min and stopped by addition of 2×RNA loading dye (New England Biolabs, Ipswich, MA, USA). Before loading ...
-
bioRxiv - Microbiology 2022Quote: CRISPR-Cas12a reactions were carried out in 20 μL reaction volumes with 2 μL NEBuffer™ r2.1 (New England Biolabs, Ipswich, Massachusetts, USA), 500 nM crRNA ...
-
bioRxiv - Genomics 2022Quote: ... and the results (Figure 2) suggested that a combination of the rare cutter HindIII and the frequent cutter Sau3AI (New England Biolabs, NEB, Ipswich, MA) would provide restriction fragments suitable for ddRAD-Seq (150-700 bp).
-
bioRxiv - Immunology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). The Hifi assembly products were Ampure bead purified and eluted into 20 µL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Biochemistry 2023Quote: ... In vitro RNA methylation experiments were performed for 2 h at 37 °C in 20 μL reaction mixtures containing 1× CutSmart buffer (New England Biolabs Inc., Massachusetts, USA) with 1 μg RNA and 1 unit RNase Inhibitor (New England Biolabs Inc. ...
-
bioRxiv - Genomics 2023Quote: LIDAR and 3’-LIDAR libraries were analyzed on a 2% agarose gel and quantified using NEBNext Library Quant Kit for Illumina (New England Biolabs, Cat. No E7630L). Libraries were sequenced on an Illumina NextSeq500.
-
bioRxiv - Molecular Biology 2023Quote: ... and produced by PCR amplification (10–13 cycles) of tagmented DNA using a NEB Next High-Fidelity 2× PCR Master Mix (New England Biolabs, Ipswich, MA, USA). DNA fragments were then purified using the MinElute PCR Purification Kit and eluted in 10 µL elution buffer ...
-
bioRxiv - Microbiology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour HiFi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). HiFi assembly products were Ampure bead purified and eluted into 20uL of H2O for higher electroporation efficiency.
-
bioRxiv - Cell Biology 2024Quote: ... and treated for 10 min at RT by RNase III enzyme (2 U of RNase III (Short Cut, New England BioLabs, Massachusetts, USA, M0245S) with 20 mM MnCl2 in 1× reaction ShortCut buffer) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and chromatin was digested overnight by adding 25 µL 10X NEBuffer 2 and 100 U Mbo I (New England Biolabs, catalog No. R0147). Digestion efficiency was confirmed by isolating DNA from a 25-µL aliquot of the suspension and performing agarose gel electrophoresis ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...