Labshake search
Citations for New England Biolabs :
1501 - 1550 of 10000+ citations for Mouse Acrosomal Protein SP 10 ACRV1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: Protein was expressed for in vitro assays in T7 Express cells (New England Biolabs, Catalog # C2566H) in 96-well deep-well plates using the pET22b(+ ...
-
bioRxiv - Cell Biology 2024Quote: ... AcGFP and TagRFP-657 proteins and SNAP-Surface 488 and Alexa 647 dyes (New England Biolabs) were measured in the same excitation and emission ranges as in flow cytometry assays ...
-
bioRxiv - Microbiology 2023Quote: ... using the kit Luna® Universal qPCR Master Mix Kit (New England Biolabs, Ipswich, MA, United States). PCRs were conducted in a total volume of 20 µl containing 10 μL of Luna Universal qPCR Mix ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli K-12 strain NEB DH-10 Beta (New England Biolabs, MA, USA) unless stated otherwise ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.4 μl of 10 U/μl T4 DNA ligase (4U final, NEB M0202L), 1X T4 DNA ligase reaction buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1 μL of 10 mM dNTPs (New England Biolabs, Ipswich, MA, USA) to 10 μL RNA and incubating at 65°C for 5 min on a C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Biophysics 2021Quote: ... following incubation for ∼2 hours of 10 mg/ml BSA (New England Biolabs) diluted in buffer A containing 20 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μL of 1× PNK mix (2 μL of 10× PNK buffer (NEB), 2 μL ATP (SCP801 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1/10 T7 RNA polymerase mix (HighScribe T7 High Yield RNA synthesis NEB)) at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... A 10 μL reaction was prepared containing 1x NEBuffer 3.1 (New England Biolabs), 5 units of endonuclease ...
-
bioRxiv - Genomics 2019Quote: ... A 10 μL reaction was prepared containing 1x ThermoPol buffer (New England Biolabs), 0.25 units of polymerase ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μM dNTPs (0.5 μl per reaction) in 1× Klenow reaction buffer (NEB). Next ...
-
bioRxiv - Genomics 2020Quote: ... and the resulting product was transformed into 10-Beta Electrocompetent cells (NEB C3020K). We plated 1% of the library to estimate complexity and grew the rest of the sample and then midi prepped (Zymo D4200 ...
-
bioRxiv - Molecular Biology 2019Quote: ... XPG solution was mixed with 10 ml of amylose resin (New England BioLabs) pre-equilibrated in dialysis buffer ...
-
bioRxiv - Genomics 2019Quote: ... This gDNA was then digested with DpnI (10 U, New England Biolabs #R0176L) in CutSmart buffer in a total volume of 10 µl at 37 °C for 8 h followed by heat inactivation at 80 °C for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was resuspended in 10 μl of nuclease free water (New England Biolabs). 5 μl of RNA solution was suspended in 5 μl of RNA loading buffer (95% (v/v ...
-
bioRxiv - Genomics 2021Quote: ... 1 µL of 10 U/µL polynucleotide T4 kinase and PNK buffer (NEB) in 20 µL ...
-
bioRxiv - Genetics 2020Quote: ... followed by gap repair by adding 2 µl of 10× NEBuffer 2 (NEB), 3 µl of dNTPs (2.5 mM each ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNAsin was replaced with 10 mM ribonucleoside vanadyl complex (New England Biolabs S1402S) was added to the ground tissue ...
-
bioRxiv - Cell Biology 2021Quote: ... and 10 mM ribonucleoside vanadyl complex (RVC; S1402S; New England Biolabs; Ipswich, MA) for 10–20 min in a 37°C water bath ...
-
bioRxiv - Bioengineering 2021Quote: ... 10 ng of purified PCR products were incubated with I-SceI endonuclease (NEB) according to manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 ng of genomic DNA was digested with 10 units of HhaI (NEB) and 2 units of HaeIII (NEB ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl of Q5 Hot Start High-Fidelity 2x Master Mix (NEB M0494S), 1 μl of 10 μM shRNA_GA_F primer (5’ GAGAACTCTGAATAGATCTGTTCTAGAAAACATCCCATAAAACATCCCATATTCA-3’) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 μL 400 U μl-1 T4 DNA Ligase (NEB, high concentration formula) and 664 μL H2O and incubated for 120 mins at 23°C with 300 rpm slow rotation ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1.mNG2(1-10) was generated through gibson assembly (NEBuilder, New England Biolabs) of a pcDNA3.1 vector (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 ng of full-length cDNA was amplified with LongAmp master mix (NEB) and TSO (5’-NNNAAGCAGTGGTATCAACGCAGAG-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2μl 10 mM dNTPs and 1μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Biophysics 2021Quote: ... following passivation for ~2 hours of 10 mg/ml BSA (New England Biolabs). After removing non-adhered BSA by washing the flow cell with PBS ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: ... followed by a 10-minute phosphatase treatment (Quick CIP, NEB Cat No. M0525) to dephosphorylate the ends ...
-
bioRxiv - Biochemistry 2022Quote: Washed RBCS were deglycosylated by incubation with 10% PNGase F (New England Biolabs) at 37°C for 2 hours ...
-
bioRxiv - Genetics 2019Quote: ... and 10 µL 2X Hot Start Taq PCR Master Mix (New England Biolabs). The cycling conditions in the Bio-Rad T100™ Thermal Cycler were ...
-
bioRxiv - Genetics 2019Quote: ... and 10 µL 2X Hot Start Taq PCR Master Mix (New England Biolabs). Samples were loaded into a Biorad T100™ Thermal Cycler for 3 minutes at 95°C ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were treated with DNase I (10 U/mL, New England Biolabs, M0303S) for 1 h at 37°C and rinsed in PBS (3 times ...
-
bioRxiv - Microbiology 2019Quote: ... and 1x T4 DNA ligase buffer with 10 mM ATP (NEB cat. # B0202). Reactions were then heat-killed at 75°C for 20 minutes and 2.5 µl of 1 µM pre-annealed ...
-
bioRxiv - Molecular Biology 2019Quote: ... Heat mediated antigen retrieval pretreatment using 10 mM Sodium Citrate buffer (Vectors Biolabs) were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated with 10 U of phosphatase-free T4 polynucleotide kinase (New England BioLabs) for 30 min at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Promoter substitution used the restriction enzymes AatII (10 units; R0117S, New England Biolabs) and NheI-HF (10 units ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1 mM SAM and 1 μl Vaccinia capping enzyme (10 units/μl, NEB). The reaction was incubated at 37 °C for 1 h and the capped RNA was purified by phenol chloroform extraction and ethanol precipitation at −20 °C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... This gDNA was then digested with DpnI (10 U, New England Biolabs #R0176L) in CutSmart buffer in a total volume of 10 μl at 37°C for 8h followed by heat inactivation at 80 °C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... The 10 μg of RNA was treated with DNaseI (New England BioLabs, USA), followed by phenol ...
-
bioRxiv - Zoology 2019Quote: ... 10 µL NEB 5X Q5® High GC Enhancer (New England BioLabs, USA), 4 µL NEB Deoxynucleotide Solution Mix (10 mM each nt ...
-
bioRxiv - Biochemistry 2021Quote: ... as described by manufacturer and transformed into heat- competent 10-Beta cells (NEB). Inserts from single colonies were PCR amplified (using primers pGEM_T7_Fo ...
-
bioRxiv - Genomics 2020Quote: ... 10 µ of 20 mg/mL BSA (New England Biolabs, catalog no. B9000S), and 930 µ of nuclease-free water ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µl Reverse External Primer (10 µM) and Nuclease-free water (NEB,USA) up to 100 µl were mixed on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... and transformed into NEB 10-beta electrocompetent E.coli (New England BioLabs Cat. #3020). DNA was extracted using a Qiagen Plasmid Midi Kit (Qiagen Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.3 μl T7E1 enzyme at 10 Units/μl (New England Biolabs, Ipswich, USA); and 3.2 μl water ...
-
bioRxiv - Microbiology 2020Quote: ... 10 pmoles of each oligonucleotide set were annealed in 1X CutSmart buffer (NEB) and 0.1 pmole of the annealed products were ligated with 50 ng of the linearized pCsm vector with T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... by incubating the DNA with T4 polynucleotide kinase (10 units; New England Biolabs) in the reaction medium provided by the supplier for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... the genome was digested by 5 μl enzyme HaeIII (10 U/μl, NEB) with 81.5 μl H2O ...