Labshake search
Citations for New England Biolabs :
1401 - 1450 of 10000+ citations for Mouse Acrosomal Protein SP 10 ACRV1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... All proteins were overexpressed in Escherichia coli BL21 Codon-Plus competent cells (C2527, New England Biolabs) and grown at 37 °C in 2 % Luria Broth containing 30 mg/L kanamycin until OD600 reached 0.6 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Embryos were injected with 200-300 pg gRNAs and 1.6 ng EnGen Cas9 protein (#M0646M NEB). The target and gRNA sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... The antibodies were captured using 50 µl of protein G magnetic beads (S1430, New England Biolabs) incubated for 60 min with end over end mixing at 4°C ...
-
bioRxiv - Microbiology 2022Quote: All recombinant proteins were expressed in Escherichia coli T7 Express lysY/Iq cells (New England Biolabs). Except for GST-PP1γ ...
-
bioRxiv - Biochemistry 2022Quote: ... CBP (Chitin Binding Protein, produced by N. Martín in Dr. Casanova’s lab, New England Biolabs Protocol) was used as a secondary antibody at 1:300 to detect chitin and visualize the tracheal branches ...
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Microbiology 2022Quote: ... individual sgRNAs and Cas9 protein in 1X NEB 3.1 buffer (New England Biolabs, Ipswich, MA, USA) were incubated at 37°C for 2 h ...
-
bioRxiv - Microbiology 2022Quote: ... The DST was removed by incubating the protein with 64 units of Enterokinase light chain (BioLabs) in 10 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2023Quote: Genetically modified zebrafish lines were created using Cas9 protein (EnGen® Spy Cas9 NLS, #M0646T, NEB) and previously established protocols combining PCR and reverse transcription to generate guide RNAs44 ...
-
bioRxiv - Microbiology 2022Quote: ... The EcRecA protein was purified in a similar manner and then compared to commercial EcRecA (NEB). The protein activity of commercial NEB and purified proteins was equivalent ...
-
bioRxiv - Microbiology 2023Quote: ... The HA protein tag and point mutations were introduced using the KLD Enzyme mix (NEB M0554S) and were verified by Sanger sequencing and whole-plasmid sequencing (Plasmidsaurus).
-
bioRxiv - Cell Biology 2023Quote: ... In some cases immunoprecipitated proteins were treated with PNGase-F or Endo-H (New England Biolabs) according to the manufacturers protocols ...
-
bioRxiv - Biochemistry 2023Quote: ... per 1 µg protein for 45 min at 30°C in PMP buffer (New England Biolabs) plus 1 mM MnCl2 ...
-
bioRxiv - Neuroscience 2023Quote: ... The lysate-antibody mix was then incubated with Magnetic Protein A beads (New England Biolabs, S1425S) overnight at 4 °C with end over rotation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Preclearing step: ∼ 50 μL magnetic beads (Protein A or G Magnetic Beads; #S1425S or #S1430S NEB) were added to the sample and incubation was carried out for 1 h on a rocking platform at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by simultaneous overnight tag cleavage by TEV and dephosphorylation by λ-protein phosphatase (NEB, P0735). The cleaved ...
-
bioRxiv - Biophysics 2023Quote: ... The labelled proteins were subjected to overnight cleavage by exogenous furin (New England Biolabs, Ipswich, MA) at 37°C to fully convert GP0 to GP1 and GP2 ...
-
bioRxiv - Bioengineering 2024Quote: ... In vitro cleavage reactions were performed on the circularized DNA using SpCas9 protein (NEB, Ipswich, MA) and KLRC1 sgRNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... Protein samples collected from culture media were treated with PNGase F enzyme (New England Biolabs, P0709S) to remove the N-linked oligosaccharides from the TECTA protein according to the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2024Quote: The glycosylation status of the proteins was studied using the PNGase-F and the EndoH (NEB) glycosidases according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... crude extracts were treated with the λ-protein phosphatase (λ-PPase; New England BioLabs, Cat# P0753S) before application on the gel ...
-
bioRxiv - Microbiology 2023Quote: ... using the kit Luna® Universal qPCR Master Mix Kit (New England Biolabs, Ipswich, MA, United States). PCRs were conducted in a total volume of 20 µl containing 10 μL of Luna Universal qPCR Mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplicon was subsequently purified with column DNA Clean-up kit (Monarch PCR & DNA Cleanup Kit, # T1030L, NEB) and mixed with double-digested Nhe1/ BamH1 and gel-purified target pCW57.1 vector in a molecular ratio of 1:2 (50 ng Vector ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli K-12 strain NEB DH-10 Beta (New England Biolabs, MA, USA) unless stated otherwise ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.4 μl of 10 U/μl T4 DNA ligase (4U final, NEB M0202L), 1X T4 DNA ligase reaction buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1 μL of 10 mM dNTPs (New England Biolabs, Ipswich, MA, USA) to 10 μL RNA and incubating at 65°C for 5 min on a C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Biophysics 2021Quote: ... following incubation for ∼2 hours of 10 mg/ml BSA (New England Biolabs) diluted in buffer A containing 20 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μL of 1× PNK mix (2 μL of 10× PNK buffer (NEB), 2 μL ATP (SCP801 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1/10 T7 RNA polymerase mix (HighScribe T7 High Yield RNA synthesis NEB)) at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... A 10 μL reaction was prepared containing 1x NEBuffer 3.1 (New England Biolabs), 5 units of endonuclease ...
-
bioRxiv - Genomics 2019Quote: ... A 10 μL reaction was prepared containing 1x ThermoPol buffer (New England Biolabs), 0.25 units of polymerase ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μM dNTPs (0.5 μl per reaction) in 1× Klenow reaction buffer (NEB). Next ...
-
bioRxiv - Genomics 2020Quote: ... and the resulting product was transformed into 10-Beta Electrocompetent cells (NEB C3020K). We plated 1% of the library to estimate complexity and grew the rest of the sample and then midi prepped (Zymo D4200 ...
-
bioRxiv - Molecular Biology 2019Quote: ... XPG solution was mixed with 10 ml of amylose resin (New England BioLabs) pre-equilibrated in dialysis buffer ...
-
bioRxiv - Genomics 2019Quote: ... This gDNA was then digested with DpnI (10 U, New England Biolabs #R0176L) in CutSmart buffer in a total volume of 10 µl at 37 °C for 8 h followed by heat inactivation at 80 °C for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was resuspended in 10 μl of nuclease free water (New England Biolabs). 5 μl of RNA solution was suspended in 5 μl of RNA loading buffer (95% (v/v ...
-
bioRxiv - Genomics 2021Quote: ... 1 µL of 10 U/µL polynucleotide T4 kinase and PNK buffer (NEB) in 20 µL ...
-
bioRxiv - Genetics 2020Quote: ... followed by gap repair by adding 2 µl of 10× NEBuffer 2 (NEB), 3 µl of dNTPs (2.5 mM each ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNAsin was replaced with 10 mM ribonucleoside vanadyl complex (New England Biolabs S1402S) was added to the ground tissue ...
-
bioRxiv - Cell Biology 2021Quote: ... and 10 mM ribonucleoside vanadyl complex (RVC; S1402S; New England Biolabs; Ipswich, MA) for 10–20 min in a 37°C water bath ...
-
bioRxiv - Bioengineering 2021Quote: ... 10 ng of purified PCR products were incubated with I-SceI endonuclease (NEB) according to manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 ng of genomic DNA was digested with 10 units of HhaI (NEB) and 2 units of HaeIII (NEB ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl of Q5 Hot Start High-Fidelity 2x Master Mix (NEB M0494S), 1 μl of 10 μM shRNA_GA_F primer (5’ GAGAACTCTGAATAGATCTGTTCTAGAAAACATCCCATAAAACATCCCATATTCA-3’) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 μL 400 U μl-1 T4 DNA Ligase (NEB, high concentration formula) and 664 μL H2O and incubated for 120 mins at 23°C with 300 rpm slow rotation ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1.mNG2(1-10) was generated through gibson assembly (NEBuilder, New England Biolabs) of a pcDNA3.1 vector (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 ng of full-length cDNA was amplified with LongAmp master mix (NEB) and TSO (5’-NNNAAGCAGTGGTATCAACGCAGAG-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2μl 10 mM dNTPs and 1μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Biophysics 2021Quote: ... following passivation for ~2 hours of 10 mg/ml BSA (New England Biolabs). After removing non-adhered BSA by washing the flow cell with PBS ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: ... followed by a 10-minute phosphatase treatment (Quick CIP, NEB Cat No. M0525) to dephosphorylate the ends ...