Labshake search
Citations for New England Biolabs :
1501 - 1550 of 6282 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... All mutants (Arp2D subdomain 2 swap, Arp2D-2CT, and Arp2-2DCT) were generated using Q5 site-directed mutagenesis (NEB). All genes were cloned into a vector encoding an attB site and superfolder GFP under the control of an eye-specific promoter (3XP3) ...
-
bioRxiv - Developmental Biology 2023Quote: ... A primer set annealing to the amplification sequences was used at a final concentration of 0.5 μM to amplify the pool of oligonucleotides using 12.5 μL 2 x NEBnext PCR master mix (New England BioLabs) and 3 μL of oligonucleotide pool (∼3 ng) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of iTP_3’_linker_ApoI (10 μM) and 0.5 μl of ligase (T4 RNA ligase 2, truncated - 200 000 U/ml - New England Biolabs) per reaction ...
-
bioRxiv - Biochemistry 2023Quote: Approximately 100 µg of extracted protein was incubated with 2 µL (1,000 U) of PNGase F (New England Biolabs) at 37°C for 48 hrs ...
-
bioRxiv - Genetics 2023Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Microbiology 2023Quote: The pGEX-6P-PrkA1-338 plasmid (Table 2) was constructed by a two-part ligation (NEB Quick Ligation kit) of BamHI- and NotI-linearized pGEX-6P and PCR-generated prkA1-338 amplified with primers AS21 and AS81 (Table 3 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified pegRNA/ngRNA pair sequences from each sample using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... To produce the ABI1 Isoform 2 deleted SH3 domain we performed Q5 site-directed mutagenesis (New England Biolabs Inc.) with forward primer 5’-TAGCTCGAGGTTAACGAATTC - 3’ and reverse primer 5’-TTTCTCAATATAATTCTTGGGG - 3’ synthesized by IDT and then verified the sequence (Genewiz) ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified PCR products were ran on 2% agarose gel and stained with ethidium bromide solution (New England Biolabs Inc.). Gel photographs were taken using ChemiDoc MP gel documentation system (BIO-RAD).
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 0.5 μl of 100 mM phenylmethylsulfonyl fluoride] and incubated with micrococcal nuclease (2 × 103 U/ml; New England Biolabs) for 2 hours at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Single cells of two untreated CeD patients were sorted into 96-well plates containing 2 µl of scRNA-seq catch buffer (0.2% vol/vol Triton X-100 [Sigma] in H2O with 2 U/μl RNase inhibitor [New England Biolabs]) per well using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Immunology 2023Quote: ... and ligated with custom UMI adapters (IDT) (Table S2) at 2 uM according to NEBNext Ultra II instructions (NEB). Libraries were prepped following NEBNext Immune Sequencing Kit’s protocol (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were digested with 0.4 μl of restriction enzyme NlaIII for 2 hours at 37°C (New England Biolabs). Digested PCR products were run on 2% agarose gels with SYBR Safe (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... for the elution from the columns 2 pg of Tn5-digested and purified lambda DNA (New England Biolabs, # N3011S) were added to be used as spike-in normalizer for later analysis ...
-
bioRxiv - Genomics 2024Quote: ... 2 µg of the plasmids containing the reporters and promoters (pJL206 or pJL261) were linearized with BciVI (NEB, R0596S) for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR fragments were cloned into psiCHECK-2 using the restriction enzymes XhoI/NotI or SglI/NOTI (New England Biolabs). Ligations were performed with a quick ligation kig (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... Samples were then processed for library barcoding and amplification with Q5 High-Fidelity 2× Master Mix (cat. M0492S, NEB). Prepared libraries were sent for sequencing after quantification using Qubit and size distribution as determined using an Agilent 4200 TapeStation.
-
bioRxiv - Microbiology 2024Quote: ... The RT RNA sample (5 μL) was amplified using the LongAmp Taq 2× Master Mix (NEB, Ipswich, MA, USA) with IVT Nanopore T7 Fw and IVT Nanopore T7 Rv primers (Supplementary Table 5) ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 pmol forward oligo and 100 pmol reverse oligo were resuspended in 25 μL 1x NEBuffer 2 (NEB, B7002S). The solution was incubated in a 95 °C water bath for 4 min then slowly cooled (∼0.5 °C/min ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mix was incubated at 37°C and 15 ul aliquots were removed at indicated time points, quenched into stop buffer (1.8% SDS, 10 mM EDTA) followed by Proteinase-K (2 units total) (NEB) treatment for 45 min at 50°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.4 mM phenylmethylsulfonyl fluoride (PMSF) and 4 µM pepstatin) and digested with the chosen endoglycosidase (PNGase F, New England Biolabs; or Endoglycosidase H, Roche) in a small volume of the appropriate buffer ...
-
bioRxiv - Biophysics 2021Quote: ... 4 µL of 0.2 mg/mL of streptavidin (NEB; N7021S) in crystallization buffer were added to the biotinylated lipid surface and incubated for 30 min in a humidity chamber at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... β1-4 galatosidase or α2-3,6,8 Neuraminidase (New England BioLabs) at concentration of 5000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of T4 DNA ligase (40U final, NEB M0202L), 1X T4 DNA ligase reaction buffer ...
-
bioRxiv - Genomics 2021Quote: ... and 4 μl 5 U/μL I-SceI (NEB, #R0694L) in a 50 μL final volume for 3 hours at 37°C ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 10× T4 RNA ligase buffer (New England Biolabs), 4 μl T4 RNA ligase ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 μl LunaScript RT SuperMix (5X) (New England Biolabs) was added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µl of 3U/µl NEB T4 DNA polymerase (NEB), and 1 µl of 5U/µl NEB DNA polymerase I ...
-
bioRxiv - Plant Biology 2021Quote: ... The 4 fragments were fused together using NEB builder (NEB). The reaction was amplified by PCR for 30 cycles and transformed into B ...
-
bioRxiv - Genomics 2022Quote: ... and resolved on a 4–20% SDS-polyacrylamide gel (NEB). The presence of MeCP2 was assayed by western blotting using anti-MeCP2 monoclonal antibody M6818 (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of thermolabile proteinase K (New England Biolabs, P811S) added to Mitochondria-bound beads resuspended in 30 µl of KPBS ...
-
bioRxiv - Genetics 2023Quote: ... column-purified and transformed in 4 or 5 electroporations (NEB 10-beta Electrocompetent E ...
-
bioRxiv - Biophysics 2023Quote: ... “no SDS” loading dye (New England Biolabs, UK; 4 µL) was added to each sample (15 µL ...
-
bioRxiv - Systems Biology 2023Quote: ... and SpeI-HF (New England Biolabs, Ipswitch, MA;, and 4) the barcode fragment digested with BstEII-HF (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min75 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100 pmol of the oligonucleotides 5’-ATTGTCATACCGATCCCAATTCGA-3’ and 5’-AAACTCGAATTGGGATCGGTATGAC-3’ were phosphorylated for 30 min at 37 °C using 1 mM ATP and 1 unit polynucleotide kinase (NEB) in the buffer supplied by the manufacturer and then hybridized in a thermocycler (5 min 95 °C ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 µM of the 6-kb fragment was incubated with 1 unit/µL terminal deoxynucleotidyl transferase (TdT, New England Biolabs, MA, USA, #M0315S) and 0.5 mM deoxyadenosine triphosphate (dATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ RNA linker (20 µM) (Dharmacon, 5’-phosphate-AGAUCGGAAGAGCGGUUCAG-3’ was added by T4 RNA Ligase 1 (NEB M0204) at 16°C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in mec4p::Lamp-1::GFP.
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were incubated at 37°C and stopped for indicated time periods and the reaction was stopped by addition of 2 × RNA loading dye (New England Biolabs). For electrophoresis ...