Labshake search
Citations for New England Biolabs :
101 - 150 of 930 citations for Tripartite Motif Containing 22 TRIM22 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37℃ and were finally washed once with 0.1x SSC buffer.
-
bioRxiv - Plant Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 3 hours at 37 °C and were finally washed once with 0.1x SSC buffer ...
-
bioRxiv - Genetics 2021Quote: ... We injected worms with an injection mix containing Cas9 EnGen (NEB), 4 sgRNAs against mir-1 (AAGAAGTATGTAGAACGGGG ...
-
bioRxiv - Microbiology 2019Quote: ... plasmids containing sgRNAs were co-transfected with NotI (New England Biolabs)-linearized pTKO ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 150ul of 10X NEB T4 DNA ligase buffer (NEB, B0202), 125ul of 10% Triton X-100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Immunology 2020Quote: ... 0.09% Tween-20) containing 0.2 mg/ml protease K (NEB, P8107S) and incubating at 56°C for 1 hour ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20µL of digestion mix containing 125U HinfI (New England BioLabs, #R0155M) and 25U RsaI (New England BioLabs ...
-
bioRxiv - Neuroscience 2021Quote: Samples containing Nluc-GPC4 were treated with Heparinase II (NEB P0735S) and Heparinase III (NEB P0737S ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5caC and 5fC containing oligonucleotides were synthesized by NEB (Ipswich, MA). dsDNA oligonucleotides were annealed in 10 mM Tris–HCl ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the PURExpress® kit containing Solution A and Solution B (NEB) was used to prepare the transcription-translation reaction ...
-
bioRxiv - Bioengineering 2024Quote: ... pH 8.0) containing 8 units mL−1 proteinase K (NEB, P8107S) at 37 °C for 4 h ...
-
bioRxiv - Cell Biology 2023Quote: ... A mixture containing 600 ng/uL of Cas9 protein (NEB: M0386) and sgRNA complex at a 1:1 ratio was generated with a total volume of 3 uL ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein-containing fractions were pooled and incubated with Chitin Resin (NEB) for 30 min at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 6 µl NEBuffer 2 (New England Biolabs, B7002S), 2 µl Klenow enzyme (5 units/µl ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37°C and were finally washed once with 0.1x SSC buffer.
-
bioRxiv - Cell Biology 2024Quote: H in the reaction buffer containing GlycoBuffer 3 (B1720S, NE BioLabs) for 1 h at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... containing either 400 U/mL of BamHI-HF (NEB; cat# R3136S) or EcoRI-HF (NEB ...
-
bioRxiv - Genomics 2019Quote: ... For that the mix containing 2 µL of RNAse H (NEB, #M0297S), 1 µL of E ...
-
bioRxiv - Neuroscience 2021Quote: ... Beads were then incubated with 100 μl reaction buffer (containing 1X NEB heparinase mix diluted in dH2O ...
-
bioRxiv - Cell Biology 2021Quote: ... from pSJ1256 using primers containing the PacI and AscI (New England BioLabs) restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amplicons containing the sgRNA sequences were amplified using NEBNext High-Fidelity (NEB) and their representation was analyzed by next-generation sequencing (HiSeq2500 ...
-
bioRxiv - Cell Biology 2022Quote: ... The cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37°C and were washed once with 0.1x SSC buffer ...
-
bioRxiv - Genetics 2019Quote: ... the TOPO vector containing the insert fragment was digested with BsmBI (NEB) and the 83-nt insert fragment was gel-purified on a 4% agarose gel ...
-
bioRxiv - Plant Biology 2020Quote: pGEMHE-DEST containing GmSALT3 was linearized using SphI-HF (New England BioLabs); cRNA was synthesized using mMESSAGE mMACHINE T7 Kit (Ambion) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phusion HF reaction buffer containing 1.5 mM MgCl2 (New England Biolabs Inc), 200 mM of each dNTP ...
-
bioRxiv - Bioengineering 2024Quote: ... A mastermix containing 2 mmol/L of each dNTP (NEB, Ipswich, MA), 4.5 µg of random hexamers (ThermoFisher ...
-
bioRxiv - Bioengineering 2024Quote: ... containing uracil and overhangs compatible with Thermolabile USER II digestion/ligation (NEB). Following outPCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... Eluates containing MBP-fusions were applied to 5 mL amylose resin (NEB) columns and extensively washed with 20 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2023Quote: ... in 20 μL of reaction mixture containing 1x NEB3 buffer (NEB, USA) and 1 U/μL RNasin Plus RNase Inhibitor (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 3 hours at 55°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing a hygromycin resistance cassette using BamHI-HF and NotI-HF (NEB) restriction enzymes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Genomics 2019Quote: ... A 10 μL reaction was prepared containing 1x NEBuffer 3.1 (New England Biolabs), 5 units of endonuclease ...
-
bioRxiv - Genomics 2019Quote: ... A 10 μL reaction was prepared containing 1x ThermoPol buffer (New England Biolabs), 0.25 units of polymerase ...
-
bioRxiv - Synthetic Biology 2019Quote: ... in a 50 µL reaction containing 1x Q5 polymerase reaction buffer (NEB, B9072S) and 2.5 mM each of dATP (NEB ...
-
bioRxiv - Biochemistry 2019Quote: The plasmid containing the construct was linearized with Not-I HF enzyme (NEB) at 37°C for 2 h ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB), followed by ligation reaction at 16°C for 4.5 h and then at room temperature for 30 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing DpnII buffer to 1x final concentration and 150 units DpnII (NEB, R0543). The digestion was incubated overnight at 37C with gentle rocking ...
-
bioRxiv - Zoology 2019Quote: ... DNA fragments containing ORFs were digested with restriction enzymes (New England BioLabs, UK) and ligated into restricted pYES2 yeast expression vectors (Invitrogen ...
-
bioRxiv - Plant Biology 2020Quote: ... pGEMHE-DEST containing TaHKT1;5-D was linearized using sbfI-HF (New England Biolabs) before synthesising cRNA using the mMESSAGE mMACHINE T7 Kit (Ambion ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 2□ μl of 1× NEB Next Cell Lysis Buffer (New England Biolabs). FACS sorting was performed with a BD Influx sorter (BD Biosciences ...
-
bioRxiv - Genomics 2020Quote: ... followed by addition of 20 μl Ligation master mix (containing: 15 μl NEB Quick ligation buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Amplifications were performed in 100 µl reactions containing 1X Phusion HF buffer (NEB), 1 µM of each primer (ordered from IDT) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell lysates were applied to a column containing amylose resin (New England Biolabs). The beads were washed with at least ten column volumes of buffer containing 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Molecular Biology 2022Quote: ... resuspended in 400 μl of TM2 buffer containing micrococcal nuclease (New England Biolabs) and 1mM CaCl2 ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... digested in buffer containing 10 mM DTT with Proteinase K (New England Biolabs), and expanded in ultrapure water as for the cell work ...
-
bioRxiv - Biochemistry 2023Quote: ... the REC114-MEI4 protein-containing supernatants were loaded onto an Amylose resin (NEB). After extensive washing with a buffer containing 20mM Tris pH 8 ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.05% Tween-20) containing 10 µMnt of circular ssDNA (PhiX174 virion DNA, NEB) immobilised on magnetic Streptavidin-coated beads (Dynabeads M-280 ...