Labshake search
Citations for New England Biolabs :
101 - 150 of 6572 citations for Mono 3 Carboxypropyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: 10 ug of protein extract were digested with PNGaseF (NEB) according to manufacturer instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Total of 60 ug of trypsin (mass spectrometry grade, NEB) was diluted in 25 mM NH4HCO3 and added to dried gel pieces (3x volume of the gel volume) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mono and di-nucleosome DNA bands were excised from the gel and purified by β-agarase (NEB) digestion followed by phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Molecular Biology 2021Quote: ... before incubation during 6 min in 50μl of PNK reaction mix (1x PNKT, 1 mM ATP and 0.05 U/ml T4 PNK 3′phosphatase minus (NEB) in a thermomixer at 37°C and 1400rpm ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 50 ul PCR reactions were set up with approximately 1 ug cDNA and Phusion High-Fidelity DNA Polymerase (NEB) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Biophysics 2021Quote: ... was annealed with primer P3 (100 bp long) at a 1:3 DNA to primer molar ratio and ligated using T4 DNA ligase (NEB, catalog #M0202S). Primer P3 had biotin modification at its 3’ end ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... and RNasin (New England BioLabs UK, 100 U/mL).16 For nested PCR experiments ...
-
bioRxiv - Systems Biology 2022Quote: ... 100 U/ml T4 DNA polymerase (NEB, cat. # M0203L), 33 U/ml Klenow fragment (NEB ...
-
bioRxiv - Genomics 2022Quote: ... 100 μg/ml and DNase I (New England Biolabs) 100 μg/ml in RPMI ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 100 U/ml murine RNase inhibitor (M0314, NEB)) for 20 minutes on ice ...
-
bioRxiv - Genomics 2024Quote: ... and 100 µg/mL rAlbumin (New England Biolabs B9200S) in 1X PBS ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl Antarctic Phosphatase [5k U/mL] (NEB) and 1 μl RNase inhibitor and incubating at 37 °C for 30 minutes with shaking ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... resuspended purified nuclei were incubated with 1 mM CaCl2 and 100 ku/ml micrococcal nuclease (New England Biolabs) in HB for 37°C for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 μL of 20 mg/mL Proteinase K (NEB EO0491) was added to each sample ...
-
bioRxiv - Immunology 2021Quote: ... and 375 U/mL of Klenow Fragment (3’-5’ exo-) (NEB). After cDNA synthesis and subsequent purification by AMPure XP (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2021Quote: ... equal quantities (5 ug) of untreated Ycf1 and lambda PP (NEB) treated samples were separated on two separate 10% SDS-PAGE gels ...
-
bioRxiv - Plant Biology 2023Quote: ... and cleaned up with Monarch RNA Cleanup Kit (10 ug) (NEB). These cleaned RNA samples were sent to Novogene for poly-A tail enrichment mRNA library preparation and 150 bp paired end sequencing on Illumina NovaSeq (Novogene ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... then blunted overnight at 37°C in 100 μl NEBuffer 2 with 0.1 mM dNTPs and 1 μl Klenow (NEB M0210S). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Bioengineering 2022Quote: ... 100 μg.μL-1 BSA (NEB, B9000S) to a final volume of 10 μL per smgRNA.
-
bioRxiv - Bioengineering 2022Quote: ... 100 μg.μL-1 BSA (NEB, B9000S) to a final volume of 10 μL per condition.
-
bioRxiv - Molecular Biology 2023Quote: ... 1:100 Murine RNase Inhibitor (NEB)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... in 1× NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Genomics 2020Quote: Dialyzed chromatin was utilized as input (1.5 ug) for methylation reactions with the non-specific adenine EcoGII methyltransferase (New England Biolabs, high concentration stock 2.5e4U/mL). Reactions were performed in a 200uL reaction with 1X CutSmart Buffer and 1mM S-adenosyl-methionine (SAM ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1× NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme [NEB]) and incubated at 37 °C for 3 hours with constant shaking ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli Poly(A) polymerase and 5’-ends were converted to mono-phosphates by incubation with RNA 5’ Pyrophosphohydrolase (NEB). Subsequently ...
-
bioRxiv - Genomics 2023Quote: ... A mono-phosphate group was then added back to the 5’-end of RNAs by polynucleotide kinase (PNK, NEB) in the presence of 10mM ATP ...
-
bioRxiv - Microbiology 2021Quote: Protein samples were generated by collecting the pellet for 1 ml of cells at OD600 ∼ 1.0 and lysing with 100 µl 1X SDS sample buffer (New England Biolabs) and DTT by boiling for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... 500 µl lysed cells were then transferred to a tube containing 4.5 ml digestion buffer (1% Triton X-100, 1x CutSmart buffer (New England Biolabs)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Zoology 2021Quote: ... amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA). Expected PCR product sizes of the first step and nested PCR step were 514 and 148 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Evolutionary Biology 2021Quote: ... We isolated poly-adenylated RNA from 1 ug of total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) and constructed sequencing libraries with the NEBNext Ultra II RNA Library Prep kit (NEB #E7770 ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 100 μg/mL RNase A (New England Biolabs, USA) for 15 min at 37°C and away from light ...