Labshake search
Citations for New England Biolabs :
451 - 500 of 6572 citations for Mono 3 Carboxypropyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 1 μL of Endonuclease IV (10,000 U/ml, NEB) was added to the reaction ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µL of T4 DNA ligase (400,000U/mL, NEB) and 2 µL ddH2O ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.02 mg/ml DNase 1 (New England Biolabs, USA), 0.2 mg/ml dispase (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μl of 5000 units/ml RNaseH (NEB, M0297L) was used per µg of DNA and incubated for 48 hours at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... once with 1 mL T4 ligase reaction buffer (NEB) and then resuspended in 50 μL of end-repair reaction mix (0.4 mM of dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL Proteinase K (800 units/ml, NEB, # P8107S) was diluted in 20 μL H2O and added to the thermocycled emulsions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL NEB Taq polymerase (5000U/mL) (BioLabs, # M0267S), 1 μL MgCl2 (25 mM ...
-
bioRxiv - Genomics 2023Quote: ... 1% (v/v) BSA (20 mg/ml, NEB, B9000S) + 5μL of hash oligo (10 uM ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% (v/v) BSA (20 mg/ml, NEB, B9000S) + 5μL of hash oligo (10 uM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1% SDS and 10 U/ml Proteinase K (NEB), followed by an 18-hour incubation at 56 °C with vigorous shaking ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 U/mL murine RNase inhibitor (New England Biolabs), 60 nM linearized plasmid template ...
-
bioRxiv - Cell Biology 2019Quote: ... the HeLa cells were kept in HeLa culture media treated overnight with 0.2 U/mL of □2-3,6,8,9 Neuraminidase (New England Biolabs) to cleave sialic acid from the cell surface glycans.
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Systems Biology 2023Quote: ... 400 µL of RNAlater and 2 µL of 20 mg/mL BSA (New England Biolabs # B9000S) were added to the samples and incubated on ice for 5 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... 40 U/mL Rnasin) and then resuspended in ligation buffer plus 2 μM SplintR Ligase (NEB). Cells were incubated for 1h at 37 ºC with gentle agitation.
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei, NEB R0710S) were added ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB), followed by ligation reaction at 16°C for 4.5 h and then at room temperature for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 uM (in ntds; ~100 pM molecules) bacteriophage lambda DNA (New England Biolabs), 25 nM fSSB (tetramer ...
-
bioRxiv - Plant Biology 2022Quote: ... Of each entry plasmid 100 ng was combined with 1× Cutsmart buffer (NEB), 1 mM ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 ng/µL injection mix (70 ng/µL 1 kb DNA ladder (NEB), 30 ng/µL plasmid of interest ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
Suppressing STAT3 activity protects the endothelial barrier from VEGF-mediated vascular permeabilitybioRxiv - Molecular Biology 2020Quote: ... to a final concentration of 0.1µg/ml was incubated with 3 µg purified STAT3 proteins as well as 5 µl ATP (New England Biolabs; N0440S) for 30 minutes at 30°C ...
-
bioRxiv - Microbiology 2021Quote: ... Non-encapsidated nucleic acids were removed by mixing 900 μL of each sample with 100 μL 10x DNase buffer and supplemented with 2 μL (4 U) of DNase I (NEB) and 1 U of RNase ...
-
bioRxiv - Plant Biology 2021Quote: ... One μl of each 100 μM oligo was added to 500 μl 1x NEB buffer 2 (New England Biolabs, www.neb.com). The p201N:Cas9 plasmid was linearized by digestion with Spe1 (www.neb.com ...
-
bioRxiv - Molecular Biology 2022Quote: ... The end-repaired cDNA was ligated with 2 μL barcoded adaptor (100-466-000, Pacific Biosciences) with T4 DNA Ligase (M0202, New England Biolabs) in 50 μL reaction volume at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 cells were isolated directly into low protein binding eppendorfs containing 2 ul NEBNext Single Cell Lysis Buffer (NEB, E5530S). Samples were kept on dry ice until transfer to −80 C for overnight storage.
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... Experiments comparing the impact of DNase I and RNase A on the migration of AbmR by SEC were completed by adding approximately 200 ug of purified AbmR 39S complexes to 20 units of DNase I (New England Biolabs) or 50 ug/ml of protease-free RNase A (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 8 ug of <200nt RNA per sample was mixed to an equal volume of 2x loading dye (NEB #B0363A) and incubated at 70°C for 5min ...
-
bioRxiv - Cell Biology 2019Quote: ... 95°C for 10 minutes and equal amounts of lysates (180 ug) were treated with either 1uL of EndoH (NEB), PNGase F (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Poly(A)+ RNA transcript was isolated from 1 ug purified total RNA (RNA integrity number >9.0) with NEBNext poly(A) mRNA magnetic isolation module (New England Biolabs #E7490). RNA-seq libraries were prepared with NEBNext Ultra Directional RNA library preparation kit for Illumina (New England Biolabs #E7420S ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 100 ng of DNA was cleaved with PstI HF and MseI restrictases in CutSmart® buffer (New England Biolabs; 3 hours at 37°C). P1 and P2 barcoded adapters corresponding to the restriction site of the enzymes were ligated immediately afterwards with T4 ligase (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Pathology 2019Quote: ... 1 μL (2 units) DNAse I (M0303S, New England BioLabs, Ipswich, MA), and 89 μL nuclease-free H2O ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101 ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μL of a 0.4 µg µL-1 stock of Trypsin (NEB) were added to the samples (to a final enzyme:substrate ratio of 1:50 w/w ...
-
bioRxiv - Genetics 2022Quote: ... were ligated using a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... excess gel was removed and embedded specimen were placed in digestion buffer (1X TAE, 0.5% Triton X-100, 0.8 M guanide HCL) with 8 units/ml Proteinase K (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2.5μL of 20% Triton X-100, 1μL BSA (100x, 10mg/mL) and 10μL HaeIII (10U/μL, NEB, R0108S) with shaking at 37°C overnight ...